Incidental Mutation 'R0364:Inpp4b'
Institutional Source Beutler Lab
Gene Symbol Inpp4b
Ensembl Gene ENSMUSG00000037940
Gene Nameinositol polyphosphate-4-phosphatase, type II
MMRRC Submission 038570-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R0364 (G1)
Quality Score225
Status Validated
Chromosomal Location81342556-82127914 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81997314 bp
Amino Acid Change Threonine to Serine at position 492 (T492S)
Ref Sequence ENSEMBL: ENSMUSP00000150541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042529] [ENSMUST00000109851] [ENSMUST00000109852] [ENSMUST00000169116] [ENSMUST00000169387] [ENSMUST00000170160] [ENSMUST00000172031] [ENSMUST00000213285] [ENSMUST00000215332] [ENSMUST00000217122]
Predicted Effect probably benign
Transcript: ENSMUST00000042529
AA Change: T475S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000044466
Gene: ENSMUSG00000037940
AA Change: T475S

C2 40 147 1.72e0 SMART
low complexity region 302 319 N/A INTRINSIC
low complexity region 425 434 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109851
AA Change: T360S

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105477
Gene: ENSMUSG00000037940
AA Change: T360S

low complexity region 22 35 N/A INTRINSIC
low complexity region 187 204 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
transmembrane domain 783 805 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109852
AA Change: T492S

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105478
Gene: ENSMUSG00000037940
AA Change: T492S

C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
transmembrane domain 915 937 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169116
AA Change: T492S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000131947
Gene: ENSMUSG00000037940
AA Change: T492S

C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169387
Predicted Effect probably benign
Transcript: ENSMUST00000170160
AA Change: T307S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000132156
Gene: ENSMUSG00000037940
AA Change: T307S

low complexity region 134 151 N/A INTRINSIC
low complexity region 257 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172031
AA Change: T492S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000131324
Gene: ENSMUSG00000037940
AA Change: T492S

C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213285
AA Change: T492S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000215332
AA Change: T492S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000217122
AA Change: T492S

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.0866 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INPP4B encodes the inositol polyphosphate 4-phosphatase type II, one of the enzymes involved in phosphatidylinositol signaling pathways. This enzyme removes the phosphate group at position 4 of the inositol ring from inositol 3,4-bisphosphate. There is limited data to suggest that the human type II enzyme is subject to alternative splicing, as has been established for the type I enzyme. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit osteoporosis, reduced long bone length, increased osteoclast numbers and size, increased osteoblast numbers, and increased bone resorption and resorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G A 7: 28,611,128 probably benign Het
Ano7 A G 1: 93,388,658 D221G probably benign Het
Arhgef12 A T 9: 43,018,401 N199K probably damaging Het
Arpc2 A G 1: 74,236,887 N26S probably null Het
BC017158 C T 7: 128,290,614 R1H probably damaging Het
Camta2 G A 11: 70,683,310 T127I probably damaging Het
Ccdc13 T A 9: 121,798,216 N665I probably damaging Het
Ccdc178 C T 18: 21,915,062 R757H probably damaging Het
Cfap52 A C 11: 67,953,610 I93S possibly damaging Het
Cmklr1 A T 5: 113,614,517 L141H probably damaging Het
Crybb3 T A 5: 113,075,953 I197F probably damaging Het
Cryzl1 G A 16: 91,707,267 P97S probably benign Het
Cubn T C 2: 13,310,507 probably benign Het
Cyp2d37-ps T C 15: 82,690,052 noncoding transcript Het
Cyp4a12b C A 4: 115,432,920 N223K probably benign Het
Dennd2a T C 6: 39,508,299 T349A probably benign Het
Dnah12 A G 14: 26,724,473 T730A probably benign Het
Dock5 G A 14: 67,822,680 probably benign Het
Elac2 A G 11: 64,979,310 Y67C probably damaging Het
Elmo1 A T 13: 20,564,493 K503* probably null Het
Endou A T 15: 97,718,973 probably benign Het
Eng T C 2: 32,679,137 S559P probably benign Het
Epc2 T A 2: 49,537,133 V563E possibly damaging Het
Fbxw17 T C 13: 50,432,441 S40P possibly damaging Het
Flt4 A T 11: 49,636,991 M924L probably benign Het
Fyb A G 15: 6,580,791 K282E probably damaging Het
Gabpa T A 16: 84,857,387 N317K possibly damaging Het
Gli3 G T 13: 15,724,764 G912V probably benign Het
Gm10295 C A 7: 71,350,613 C73F unknown Het
Gm10382 G T 5: 125,389,664 probably benign Het
Gp1ba T C 11: 70,640,458 probably benign Het
Gpr146 G A 5: 139,379,178 probably benign Het
Grm5 A G 7: 88,074,386 Y628C probably damaging Het
Hexa A G 9: 59,563,935 N491D probably benign Het
Hexdc T A 11: 121,212,143 H62Q probably benign Het
Hpx G T 7: 105,596,264 Q101K probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Iqgap2 A C 13: 95,731,275 probably benign Het
Islr2 T C 9: 58,199,744 T78A possibly damaging Het
Itga9 A G 9: 118,841,142 T177A probably benign Het
Itpkc A C 7: 27,227,749 S247A possibly damaging Het
Kirrel T C 3: 87,089,799 Y287C probably damaging Het
Kiz T G 2: 146,942,156 S536R probably benign Het
Klhl9 T G 4: 88,720,290 K571N probably benign Het
Kprp A T 3: 92,824,335 Y469* probably null Het
Ksr1 A T 11: 79,029,025 probably benign Het
Lrrc37a C T 11: 103,500,640 V1320I possibly damaging Het
Ltf A T 9: 111,025,167 N350I probably benign Het
Msl3l2 G A 10: 56,115,851 R224Q possibly damaging Het
Myh6 A T 14: 54,948,347 Y1490* probably null Het
Necap1 A G 6: 122,880,769 probably benign Het
Nf1 A T 11: 79,441,957 K810* probably null Het
Nkx6-3 A G 8: 23,157,706 E227G possibly damaging Het
Nlrp1a T A 11: 71,114,004 probably benign Het
Obscn G A 11: 59,128,281 A969V probably benign Het
Olfr1080 A T 2: 86,553,779 L115Q probably damaging Het
Olfr850 G A 9: 19,477,972 Q90* probably null Het
Olfr889 A G 9: 38,116,029 T78A probably benign Het
Olfr96 T C 17: 37,226,043 L306P possibly damaging Het
Pcdhb17 C A 18: 37,485,835 A226E possibly damaging Het
Phldb1 A T 9: 44,699,335 probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Pon2 G A 6: 5,266,156 Q288* probably null Het
Prr14 G A 7: 127,474,579 R205H probably benign Het
Ptpn13 C A 5: 103,533,348 R805S probably damaging Het
Pyroxd2 A T 19: 42,747,553 V62D probably damaging Het
Rab37 G T 11: 115,156,964 C44F probably damaging Het
Rbm44 T C 1: 91,152,347 S52P probably benign Het
Scn5a T C 9: 119,522,599 D772G probably damaging Het
Slc7a5 A G 8: 121,885,015 F425L probably benign Het
Slk T A 19: 47,620,189 L527* probably null Het
Stpg4 T A 17: 87,389,714 probably null Het
Taar6 C A 10: 23,985,148 V167L probably benign Het
Tas2r123 T A 6: 132,847,681 S180R probably benign Het
Tmc2 C T 2: 130,202,103 R86W probably benign Het
Tmem200c T A 17: 68,840,548 V42E probably damaging Het
Trhde T C 10: 114,502,982 probably benign Het
Tshz1 A T 18: 84,016,124 I53N probably benign Het
Tshz3 A G 7: 36,770,533 E649G probably benign Het
Ttll7 C A 3: 146,945,181 R719S possibly damaging Het
Utp4 T C 8: 106,898,537 probably benign Het
Vmn1r35 A G 6: 66,678,843 I281T probably damaging Het
Vps39 T G 2: 120,345,638 K76T probably damaging Het
Wdr60 A G 12: 116,257,477 probably benign Het
Whamm A G 7: 81,594,051 T674A probably benign Het
Zbtb16 A G 9: 48,743,576 probably benign Het
Zfp623 T C 15: 75,948,661 S489P probably benign Het
Other mutations in Inpp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Inpp4b APN 8 81856750 missense probably damaging 1.00
IGL01481:Inpp4b APN 8 81997380 missense probably damaging 1.00
IGL01509:Inpp4b APN 8 81890703 splice site probably benign
IGL01515:Inpp4b APN 8 81952711 missense possibly damaging 0.68
IGL01607:Inpp4b APN 8 82010663 missense probably benign 0.03
IGL01643:Inpp4b APN 8 82071771 missense probably damaging 0.97
IGL01736:Inpp4b APN 8 81997339 missense probably benign 0.00
IGL02154:Inpp4b APN 8 81969501 splice site probably benign
IGL02327:Inpp4b APN 8 82041962 missense probably benign 0.01
IGL02413:Inpp4b APN 8 82033171 missense probably benign
IGL02652:Inpp4b APN 8 81770800 splice site probably benign
IGL02678:Inpp4b APN 8 81856744 missense probably damaging 1.00
IGL03146:Inpp4b APN 8 81743781 missense possibly damaging 0.61
LCD18:Inpp4b UTSW 8 81693010 intron probably benign
PIT4280001:Inpp4b UTSW 8 82034417 missense probably benign 0.00
PIT4480001:Inpp4b UTSW 8 82046267 missense probably damaging 1.00
PIT4504001:Inpp4b UTSW 8 82041935 missense probably damaging 1.00
R0083:Inpp4b UTSW 8 81741462 missense possibly damaging 0.77
R0212:Inpp4b UTSW 8 81770917 missense probably benign 0.00
R0285:Inpp4b UTSW 8 82034516 splice site probably benign
R0363:Inpp4b UTSW 8 81884257 splice site probably benign
R0471:Inpp4b UTSW 8 82041899 missense possibly damaging 0.94
R0550:Inpp4b UTSW 8 81997337 missense probably benign 0.00
R0562:Inpp4b UTSW 8 81768151 missense possibly damaging 0.88
R0661:Inpp4b UTSW 8 81741462 missense possibly damaging 0.77
R0693:Inpp4b UTSW 8 81997314 missense probably benign 0.09
R1081:Inpp4b UTSW 8 82069024 missense probably damaging 0.97
R1251:Inpp4b UTSW 8 81890753 missense probably benign 0.01
R1374:Inpp4b UTSW 8 81743816 critical splice donor site probably null
R1445:Inpp4b UTSW 8 81952834 splice site probably null
R1465:Inpp4b UTSW 8 81768157 missense probably damaging 1.00
R1465:Inpp4b UTSW 8 81768157 missense probably damaging 1.00
R1647:Inpp4b UTSW 8 81856774 splice site probably benign
R1754:Inpp4b UTSW 8 81770811 missense probably damaging 1.00
R1759:Inpp4b UTSW 8 81768103 missense probably benign 0.06
R2085:Inpp4b UTSW 8 81952274 missense probably damaging 1.00
R2156:Inpp4b UTSW 8 82048489 missense probably damaging 1.00
R2160:Inpp4b UTSW 8 82121375 nonsense probably null
R2175:Inpp4b UTSW 8 81856699 missense probably damaging 1.00
R2191:Inpp4b UTSW 8 81997302 missense probably damaging 1.00
R2401:Inpp4b UTSW 8 81997339 missense probably benign 0.00
R2475:Inpp4b UTSW 8 82041978 missense probably benign 0.09
R2512:Inpp4b UTSW 8 82010550 missense probably damaging 1.00
R2919:Inpp4b UTSW 8 81985329 missense possibly damaging 0.93
R3021:Inpp4b UTSW 8 81902838 missense possibly damaging 0.47
R3423:Inpp4b UTSW 8 81952261 missense possibly damaging 0.63
R3777:Inpp4b UTSW 8 82041992 missense possibly damaging 0.89
R3778:Inpp4b UTSW 8 82041992 missense possibly damaging 0.89
R3794:Inpp4b UTSW 8 82033216 missense probably damaging 1.00
R3795:Inpp4b UTSW 8 82033216 missense probably damaging 1.00
R4590:Inpp4b UTSW 8 81741411 start codon destroyed probably null 1.00
R4602:Inpp4b UTSW 8 81969535 missense probably damaging 0.99
R4691:Inpp4b UTSW 8 82122653 missense probably damaging 1.00
R4924:Inpp4b UTSW 8 82122624 missense probably damaging 1.00
R4992:Inpp4b UTSW 8 82033208 missense probably damaging 1.00
R5219:Inpp4b UTSW 8 81884156 missense probably benign 0.01
R5228:Inpp4b UTSW 8 81768115 missense probably damaging 0.99
R5557:Inpp4b UTSW 8 81952259 missense probably damaging 0.99
R5627:Inpp4b UTSW 8 81743816 critical splice donor site probably benign
R5691:Inpp4b UTSW 8 81890694 intron probably benign
R6186:Inpp4b UTSW 8 82046234 missense probably damaging 0.99
R6213:Inpp4b UTSW 8 81997390 missense probably damaging 1.00
R6232:Inpp4b UTSW 8 81952184 missense probably damaging 1.00
R6283:Inpp4b UTSW 8 81770833 missense probably damaging 1.00
R6302:Inpp4b UTSW 8 81768177 missense probably benign 0.00
R6309:Inpp4b UTSW 8 82041917 missense probably damaging 1.00
R6360:Inpp4b UTSW 8 81902852 missense probably benign 0.20
R6477:Inpp4b UTSW 8 81844714 splice site probably null
R6773:Inpp4b UTSW 8 81856620 intron probably benign
R6968:Inpp4b UTSW 8 81844457 missense probably benign 0.18
R7147:Inpp4b UTSW 8 81902771 missense probably damaging 1.00
R7318:Inpp4b UTSW 8 82071745 missense probably damaging 1.00
R7409:Inpp4b UTSW 8 81952685 splice site probably null
R7455:Inpp4b UTSW 8 82071703 missense probably damaging 0.99
R7632:Inpp4b UTSW 8 82046339 missense probably damaging 1.00
R7844:Inpp4b UTSW 8 81741320 start gained probably benign
R7958:Inpp4b UTSW 8 81969589 missense probably damaging 1.00
RF003:Inpp4b UTSW 8 81969521 nonsense probably null
Z1088:Inpp4b UTSW 8 82068931 critical splice acceptor site probably null
Z1176:Inpp4b UTSW 8 82069001 missense possibly damaging 0.60
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gagagagaaagagagagcgag -3'
Posted On2013-04-24