Incidental Mutation 'R0364:Olfr850'
Institutional Source Beutler Lab
Gene Symbol Olfr850
Ensembl Gene ENSMUSG00000094535
Gene Nameolfactory receptor 850
SynonymsGA_x6K02T2PVTD-13214162-13213224, MOR147-2
MMRRC Submission 038570-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R0364 (G1)
Quality Score225
Status Validated
Chromosomal Location19477301-19478248 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 19477972 bp
Amino Acid Change Glutamine to Stop codon at position 90 (Q90*)
Ref Sequence ENSEMBL: ENSMUSP00000148623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077347] [ENSMUST00000211832]
Predicted Effect probably null
Transcript: ENSMUST00000077347
AA Change: Q93*
SMART Domains Protein: ENSMUSP00000076569
Gene: ENSMUSG00000094535
AA Change: Q93*

low complexity region 10 21 N/A INTRINSIC
Pfam:7tm_4 34 311 1.8e-51 PFAM
Pfam:7TM_GPCR_Srsx 38 304 1e-6 PFAM
Pfam:7tm_1 44 293 5.1e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000211832
AA Change: Q90*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G A 7: 28,611,128 probably benign Het
Ano7 A G 1: 93,388,658 D221G probably benign Het
Arhgef12 A T 9: 43,018,401 N199K probably damaging Het
Arpc2 A G 1: 74,236,887 N26S probably null Het
BC017158 C T 7: 128,290,614 R1H probably damaging Het
Camta2 G A 11: 70,683,310 T127I probably damaging Het
Ccdc13 T A 9: 121,798,216 N665I probably damaging Het
Ccdc178 C T 18: 21,915,062 R757H probably damaging Het
Cfap52 A C 11: 67,953,610 I93S possibly damaging Het
Cmklr1 A T 5: 113,614,517 L141H probably damaging Het
Crybb3 T A 5: 113,075,953 I197F probably damaging Het
Cryzl1 G A 16: 91,707,267 P97S probably benign Het
Cubn T C 2: 13,310,507 probably benign Het
Cyp2d37-ps T C 15: 82,690,052 noncoding transcript Het
Cyp4a12b C A 4: 115,432,920 N223K probably benign Het
Dennd2a T C 6: 39,508,299 T349A probably benign Het
Dnah12 A G 14: 26,724,473 T730A probably benign Het
Dock5 G A 14: 67,822,680 probably benign Het
Elac2 A G 11: 64,979,310 Y67C probably damaging Het
Elmo1 A T 13: 20,564,493 K503* probably null Het
Endou A T 15: 97,718,973 probably benign Het
Eng T C 2: 32,679,137 S559P probably benign Het
Epc2 T A 2: 49,537,133 V563E possibly damaging Het
Fbxw17 T C 13: 50,432,441 S40P possibly damaging Het
Flt4 A T 11: 49,636,991 M924L probably benign Het
Fyb A G 15: 6,580,791 K282E probably damaging Het
Gabpa T A 16: 84,857,387 N317K possibly damaging Het
Gli3 G T 13: 15,724,764 G912V probably benign Het
Gm10295 C A 7: 71,350,613 C73F unknown Het
Gm10382 G T 5: 125,389,664 probably benign Het
Gp1ba T C 11: 70,640,458 probably benign Het
Gpr146 G A 5: 139,379,178 probably benign Het
Grm5 A G 7: 88,074,386 Y628C probably damaging Het
Hexa A G 9: 59,563,935 N491D probably benign Het
Hexdc T A 11: 121,212,143 H62Q probably benign Het
Hpx G T 7: 105,596,264 Q101K probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Inpp4b A T 8: 81,997,314 T492S probably benign Het
Iqgap2 A C 13: 95,731,275 probably benign Het
Islr2 T C 9: 58,199,744 T78A possibly damaging Het
Itga9 A G 9: 118,841,142 T177A probably benign Het
Itpkc A C 7: 27,227,749 S247A possibly damaging Het
Kirrel T C 3: 87,089,799 Y287C probably damaging Het
Kiz T G 2: 146,942,156 S536R probably benign Het
Klhl9 T G 4: 88,720,290 K571N probably benign Het
Kprp A T 3: 92,824,335 Y469* probably null Het
Ksr1 A T 11: 79,029,025 probably benign Het
Lrrc37a C T 11: 103,500,640 V1320I possibly damaging Het
Ltf A T 9: 111,025,167 N350I probably benign Het
Msl3l2 G A 10: 56,115,851 R224Q possibly damaging Het
Myh6 A T 14: 54,948,347 Y1490* probably null Het
Necap1 A G 6: 122,880,769 probably benign Het
Nf1 A T 11: 79,441,957 K810* probably null Het
Nkx6-3 A G 8: 23,157,706 E227G possibly damaging Het
Nlrp1a T A 11: 71,114,004 probably benign Het
Obscn G A 11: 59,128,281 A969V probably benign Het
Olfr1080 A T 2: 86,553,779 L115Q probably damaging Het
Olfr889 A G 9: 38,116,029 T78A probably benign Het
Olfr96 T C 17: 37,226,043 L306P possibly damaging Het
Pcdhb17 C A 18: 37,485,835 A226E possibly damaging Het
Phldb1 A T 9: 44,699,335 probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Pon2 G A 6: 5,266,156 Q288* probably null Het
Prr14 G A 7: 127,474,579 R205H probably benign Het
Ptpn13 C A 5: 103,533,348 R805S probably damaging Het
Pyroxd2 A T 19: 42,747,553 V62D probably damaging Het
Rab37 G T 11: 115,156,964 C44F probably damaging Het
Rbm44 T C 1: 91,152,347 S52P probably benign Het
Scn5a T C 9: 119,522,599 D772G probably damaging Het
Slc7a5 A G 8: 121,885,015 F425L probably benign Het
Slk T A 19: 47,620,189 L527* probably null Het
Stpg4 T A 17: 87,389,714 probably null Het
Taar6 C A 10: 23,985,148 V167L probably benign Het
Tas2r123 T A 6: 132,847,681 S180R probably benign Het
Tmc2 C T 2: 130,202,103 R86W probably benign Het
Tmem200c T A 17: 68,840,548 V42E probably damaging Het
Trhde T C 10: 114,502,982 probably benign Het
Tshz1 A T 18: 84,016,124 I53N probably benign Het
Tshz3 A G 7: 36,770,533 E649G probably benign Het
Ttll7 C A 3: 146,945,181 R719S possibly damaging Het
Utp4 T C 8: 106,898,537 probably benign Het
Vmn1r35 A G 6: 66,678,843 I281T probably damaging Het
Vps39 T G 2: 120,345,638 K76T probably damaging Het
Wdr60 A G 12: 116,257,477 probably benign Het
Whamm A G 7: 81,594,051 T674A probably benign Het
Zbtb16 A G 9: 48,743,576 probably benign Het
Zfp623 T C 15: 75,948,661 S489P probably benign Het
Other mutations in Olfr850
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02723:Olfr850 APN 9 19477509 missense probably damaging 1.00
IGL03294:Olfr850 APN 9 19477989 missense possibly damaging 0.95
PIT4305001:Olfr850 UTSW 9 19478061 missense probably damaging 1.00
R0379:Olfr850 UTSW 9 19477480 missense possibly damaging 0.75
R0449:Olfr850 UTSW 9 19478092 missense possibly damaging 0.89
R0682:Olfr850 UTSW 9 19477349 missense probably benign 0.03
R0693:Olfr850 UTSW 9 19477972 nonsense probably null
R1484:Olfr850 UTSW 9 19478127 missense probably damaging 1.00
R1599:Olfr850 UTSW 9 19478221 missense probably damaging 0.97
R1626:Olfr850 UTSW 9 19478199 missense probably damaging 1.00
R1742:Olfr850 UTSW 9 19478041 missense probably damaging 1.00
R4232:Olfr850 UTSW 9 19477726 missense probably damaging 0.98
R4237:Olfr850 UTSW 9 19477597 missense probably benign 0.00
R5116:Olfr850 UTSW 9 19477798 missense possibly damaging 0.67
R5643:Olfr850 UTSW 9 19477557 missense probably benign 0.22
R6271:Olfr850 UTSW 9 19478041 missense probably damaging 1.00
R6815:Olfr850 UTSW 9 19477765 missense probably benign 0.20
R7222:Olfr850 UTSW 9 19477467 missense probably damaging 1.00
R7592:Olfr850 UTSW 9 19477832 missense possibly damaging 0.52
RF034:Olfr850 UTSW 9 19477632 missense possibly damaging 0.46
X0058:Olfr850 UTSW 9 19478223 missense probably benign 0.10
Z1177:Olfr850 UTSW 9 19477337
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- catcctgatctttatgctggtttc -3'
Posted On2013-04-24