Incidental Mutation 'R0364:Endou'
Institutional Source Beutler Lab
Gene Symbol Endou
Ensembl Gene ENSMUSG00000022468
Gene Nameendonuclease, polyU-specific
SynonymsTcl-30, Pp11r
MMRRC Submission 038570-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0364 (G1)
Quality Score225
Status Validated
Chromosomal Location97711015-97731339 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 97718973 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023105] [ENSMUST00000100249] [ENSMUST00000230430]
Predicted Effect probably benign
Transcript: ENSMUST00000023105
SMART Domains Protein: ENSMUSP00000023105
Gene: ENSMUSG00000022468

transmembrane domain 13 35 N/A INTRINSIC
SO 127 169 1.93e-11 SMART
Pfam:XendoU 181 448 1.4e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100249
SMART Domains Protein: ENSMUSP00000097820
Gene: ENSMUSG00000022468

signal peptide 1 18 N/A INTRINSIC
SO 20 62 8.61e-9 SMART
SO 85 127 1.93e-11 SMART
Pfam:XendoU 136 407 2.8e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230430
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with protease activity and is expressed in the placenta. The protein may be useful as a tumor marker. Multiple alternatively spliced transcript variants have been found for this protein. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal splenic B cell numbers and activation-induced B cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G A 7: 28,611,128 probably benign Het
Ano7 A G 1: 93,388,658 D221G probably benign Het
Arhgef12 A T 9: 43,018,401 N199K probably damaging Het
Arpc2 A G 1: 74,236,887 N26S probably null Het
BC017158 C T 7: 128,290,614 R1H probably damaging Het
Camta2 G A 11: 70,683,310 T127I probably damaging Het
Ccdc13 T A 9: 121,798,216 N665I probably damaging Het
Ccdc178 C T 18: 21,915,062 R757H probably damaging Het
Cfap52 A C 11: 67,953,610 I93S possibly damaging Het
Cmklr1 A T 5: 113,614,517 L141H probably damaging Het
Crybb3 T A 5: 113,075,953 I197F probably damaging Het
Cryzl1 G A 16: 91,707,267 P97S probably benign Het
Cubn T C 2: 13,310,507 probably benign Het
Cyp2d37-ps T C 15: 82,690,052 noncoding transcript Het
Cyp4a12b C A 4: 115,432,920 N223K probably benign Het
Dennd2a T C 6: 39,508,299 T349A probably benign Het
Dnah12 A G 14: 26,724,473 T730A probably benign Het
Dock5 G A 14: 67,822,680 probably benign Het
Elac2 A G 11: 64,979,310 Y67C probably damaging Het
Elmo1 A T 13: 20,564,493 K503* probably null Het
Eng T C 2: 32,679,137 S559P probably benign Het
Epc2 T A 2: 49,537,133 V563E possibly damaging Het
Fbxw17 T C 13: 50,432,441 S40P possibly damaging Het
Flt4 A T 11: 49,636,991 M924L probably benign Het
Fyb A G 15: 6,580,791 K282E probably damaging Het
Gabpa T A 16: 84,857,387 N317K possibly damaging Het
Gli3 G T 13: 15,724,764 G912V probably benign Het
Gm10295 C A 7: 71,350,613 C73F unknown Het
Gm10382 G T 5: 125,389,664 probably benign Het
Gp1ba T C 11: 70,640,458 probably benign Het
Gpr146 G A 5: 139,379,178 probably benign Het
Grm5 A G 7: 88,074,386 Y628C probably damaging Het
Hexa A G 9: 59,563,935 N491D probably benign Het
Hexdc T A 11: 121,212,143 H62Q probably benign Het
Hpx G T 7: 105,596,264 Q101K probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Inpp4b A T 8: 81,997,314 T492S probably benign Het
Iqgap2 A C 13: 95,731,275 probably benign Het
Islr2 T C 9: 58,199,744 T78A possibly damaging Het
Itga9 A G 9: 118,841,142 T177A probably benign Het
Itpkc A C 7: 27,227,749 S247A possibly damaging Het
Kirrel T C 3: 87,089,799 Y287C probably damaging Het
Kiz T G 2: 146,942,156 S536R probably benign Het
Klhl9 T G 4: 88,720,290 K571N probably benign Het
Kprp A T 3: 92,824,335 Y469* probably null Het
Ksr1 A T 11: 79,029,025 probably benign Het
Lrrc37a C T 11: 103,500,640 V1320I possibly damaging Het
Ltf A T 9: 111,025,167 N350I probably benign Het
Msl3l2 G A 10: 56,115,851 R224Q possibly damaging Het
Myh6 A T 14: 54,948,347 Y1490* probably null Het
Necap1 A G 6: 122,880,769 probably benign Het
Nf1 A T 11: 79,441,957 K810* probably null Het
Nkx6-3 A G 8: 23,157,706 E227G possibly damaging Het
Nlrp1a T A 11: 71,114,004 probably benign Het
Obscn G A 11: 59,128,281 A969V probably benign Het
Olfr1080 A T 2: 86,553,779 L115Q probably damaging Het
Olfr850 G A 9: 19,477,972 Q90* probably null Het
Olfr889 A G 9: 38,116,029 T78A probably benign Het
Olfr96 T C 17: 37,226,043 L306P possibly damaging Het
Pcdhb17 C A 18: 37,485,835 A226E possibly damaging Het
Phldb1 A T 9: 44,699,335 probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Pon2 G A 6: 5,266,156 Q288* probably null Het
Prr14 G A 7: 127,474,579 R205H probably benign Het
Ptpn13 C A 5: 103,533,348 R805S probably damaging Het
Pyroxd2 A T 19: 42,747,553 V62D probably damaging Het
Rab37 G T 11: 115,156,964 C44F probably damaging Het
Rbm44 T C 1: 91,152,347 S52P probably benign Het
Scn5a T C 9: 119,522,599 D772G probably damaging Het
Slc7a5 A G 8: 121,885,015 F425L probably benign Het
Slk T A 19: 47,620,189 L527* probably null Het
Stpg4 T A 17: 87,389,714 probably null Het
Taar6 C A 10: 23,985,148 V167L probably benign Het
Tas2r123 T A 6: 132,847,681 S180R probably benign Het
Tmc2 C T 2: 130,202,103 R86W probably benign Het
Tmem200c T A 17: 68,840,548 V42E probably damaging Het
Trhde T C 10: 114,502,982 probably benign Het
Tshz1 A T 18: 84,016,124 I53N probably benign Het
Tshz3 A G 7: 36,770,533 E649G probably benign Het
Ttll7 C A 3: 146,945,181 R719S possibly damaging Het
Utp4 T C 8: 106,898,537 probably benign Het
Vmn1r35 A G 6: 66,678,843 I281T probably damaging Het
Vps39 T G 2: 120,345,638 K76T probably damaging Het
Wdr60 A G 12: 116,257,477 probably benign Het
Whamm A G 7: 81,594,051 T674A probably benign Het
Zbtb16 A G 9: 48,743,576 probably benign Het
Zfp623 T C 15: 75,948,661 S489P probably benign Het
Other mutations in Endou
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1134:Endou UTSW 15 97713866 missense probably damaging 1.00
R1418:Endou UTSW 15 97718973 splice site probably benign
R1896:Endou UTSW 15 97712992 missense probably damaging 1.00
R2960:Endou UTSW 15 97713806 missense probably damaging 1.00
R4018:Endou UTSW 15 97718937 missense probably damaging 0.99
R4618:Endou UTSW 15 97713882 missense possibly damaging 0.67
R4754:Endou UTSW 15 97726539 missense probably damaging 0.99
R4807:Endou UTSW 15 97731232 missense probably benign 0.01
R4997:Endou UTSW 15 97719577 missense probably damaging 1.00
R5321:Endou UTSW 15 97721032 missense probably damaging 0.99
R5470:Endou UTSW 15 97718955 missense probably damaging 1.00
R5604:Endou UTSW 15 97720919 missense probably benign 0.00
R5764:Endou UTSW 15 97714607 missense probably damaging 1.00
R6114:Endou UTSW 15 97713876 nonsense probably null
R6404:Endou UTSW 15 97712131 missense probably damaging 1.00
R6528:Endou UTSW 15 97719629 missense probably damaging 1.00
R7089:Endou UTSW 15 97720245 missense probably benign 0.01
R7103:Endou UTSW 15 97718929 missense probably damaging 1.00
R7382:Endou UTSW 15 97718926 nonsense probably null
R7707:Endou UTSW 15 97713102 critical splice acceptor site probably null
R7759:Endou UTSW 15 97713866 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- acatagaaaaaccctaactcaaaacc -3'
Posted On2013-04-24