Incidental Mutation 'R0367:Kcnt1'
ID 30257
Institutional Source Beutler Lab
Gene Symbol Kcnt1
Ensembl Gene ENSMUSG00000058740
Gene Name potassium channel, subfamily T, member 1
Synonyms C030030G16Rik, Slack, slo2
MMRRC Submission 038573-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R0367 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 25753807-25808285 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 25797640 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 864 (V864I)
Ref Sequence ENSEMBL: ENSMUSP00000132212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037580] [ENSMUST00000114172] [ENSMUST00000114176] [ENSMUST00000128502] [ENSMUST00000153001] [ENSMUST00000197917] [ENSMUST00000198204] [ENSMUST00000171268] [ENSMUST00000200434]
AlphaFold Q6ZPR4
Predicted Effect probably damaging
Transcript: ENSMUST00000037580
AA Change: V884I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039058
Gene: ENSMUSG00000058740
AA Change: V884I

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 252 335 1.3e-12 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 477 579 5.8e-32 PFAM
PDB:3U6N|H 794 983 6e-6 PDB
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1212 1229 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114172
AA Change: V870I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109809
Gene: ENSMUSG00000058740
AA Change: V870I

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.2e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.3e-38 PFAM
PDB:3U6N|H 792 981 7e-6 PDB
low complexity region 1057 1074 N/A INTRINSIC
low complexity region 1210 1227 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114176
AA Change: V884I

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109813
Gene: ENSMUSG00000058740
AA Change: V884I

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.1e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.2e-38 PFAM
PDB:3U6N|H 794 983 6e-6 PDB
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145544
Predicted Effect probably damaging
Transcript: ENSMUST00000153001
AA Change: V192I

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142532
Gene: ENSMUSG00000058740
AA Change: V192I

DomainStartEndE-ValueType
PDB:4HPF|B 79 285 6e-9 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000197917
AA Change: V882I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143106
Gene: ENSMUSG00000058740
AA Change: V882I

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.2e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.3e-38 PFAM
PDB:3U6N|H 792 981 7e-6 PDB
low complexity region 1057 1074 N/A INTRINSIC
low complexity region 1210 1227 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198204
AA Change: V850I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142870
Gene: ENSMUSG00000058740
AA Change: V850I

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:Ion_trans_2 221 301 5e-11 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:BK_channel_a 441 546 1.2e-35 PFAM
PDB:3U6N|H 760 949 6e-6 PDB
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1157 1174 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171268
AA Change: V864I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132212
Gene: ENSMUSG00000058740
AA Change: V864I

DomainStartEndE-ValueType
transmembrane domain 78 97 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:Ion_trans_2 235 315 5.1e-13 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Pfam:BK_channel_a 455 560 3.2e-38 PFAM
PDB:3U6N|H 774 963 7e-6 PDB
low complexity region 1039 1056 N/A INTRINSIC
low complexity region 1192 1209 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200434
AA Change: V848I

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143482
Gene: ENSMUSG00000058740
AA Change: V848I

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:Ion_trans_2 221 301 5.1e-11 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:BK_channel_a 441 546 1.3e-35 PFAM
PDB:3U6N|H 758 947 6e-6 PDB
low complexity region 1023 1040 N/A INTRINSIC
low complexity region 1176 1193 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199269
Meta Mutation Damage Score 0.2148 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene encodes a member of the Slo potassium channel family that has shown to be activated by both sodium and chloride ions. This channel represents the largest potassium channel subunit yet identified. This channel may be important in development and pain signaling. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired action potential firing in sensory neurons and increased mechanical hypersensitivity in neuropathic pain models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 77,049,961 (GRCm39) S12P probably damaging Het
Alx4 T A 2: 93,498,953 (GRCm39) D228E probably damaging Het
Antxr2 T C 5: 98,177,455 (GRCm39) E71G probably benign Het
Arhgap19 C A 19: 41,790,417 (GRCm39) G17V probably benign Het
C8a A C 4: 104,719,791 (GRCm39) probably null Het
Ccne2 T A 4: 11,201,426 (GRCm39) probably benign Het
Cdc42bpg G A 19: 6,361,425 (GRCm39) C317Y probably damaging Het
Cend1 C A 7: 141,007,808 (GRCm39) R4L probably damaging Het
Cfap44 T C 16: 44,253,839 (GRCm39) probably null Het
Cpt1c T C 7: 44,608,999 (GRCm39) N774S probably benign Het
Csmd1 C T 8: 15,967,270 (GRCm39) D3198N probably damaging Het
Dapk2 C T 9: 66,176,168 (GRCm39) S323F probably damaging Het
Ddx60 T G 8: 62,470,783 (GRCm39) I1425R possibly damaging Het
Edem1 T A 6: 108,823,713 (GRCm39) Y370N probably damaging Het
Elp5 A G 11: 69,865,967 (GRCm39) V103A probably benign Het
Fads1 C T 19: 10,160,429 (GRCm39) P5L probably benign Het
Fat1 A G 8: 45,477,350 (GRCm39) D2132G probably damaging Het
Fat2 A T 11: 55,182,919 (GRCm39) probably benign Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gp2 C T 7: 119,053,791 (GRCm39) D57N probably damaging Het
Gpr161 T C 1: 165,144,805 (GRCm39) probably benign Het
Gstcd G A 3: 132,692,138 (GRCm39) probably benign Het
Hipk3 A T 2: 104,261,594 (GRCm39) C980* probably null Het
Htr2a A T 14: 74,879,649 (GRCm39) I93L probably damaging Het
Itpr2 T G 6: 146,135,506 (GRCm39) K1775N probably damaging Het
Kcnt2 A T 1: 140,278,963 (GRCm39) Y38F probably damaging Het
Limch1 G A 5: 67,015,297 (GRCm39) probably null Het
Lmtk2 C T 5: 144,111,103 (GRCm39) R608C possibly damaging Het
Loxhd1 C T 18: 77,513,453 (GRCm39) probably benign Het
Lpin2 A T 17: 71,522,017 (GRCm39) E17V probably damaging Het
Lrrc34 A T 3: 30,684,142 (GRCm39) F342I probably benign Het
Lyzl6 A G 11: 103,527,578 (GRCm39) probably null Het
Map3k4 A C 17: 12,476,928 (GRCm39) probably benign Het
Mocs3 C T 2: 168,073,602 (GRCm39) P350S probably benign Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Or1ad8 A G 11: 50,897,904 (GRCm39) Y35C probably damaging Het
Or4c52 A C 2: 89,846,116 (GRCm39) I281L probably damaging Het
Or7e168 G T 9: 19,719,839 (GRCm39) S75I probably damaging Het
Pcare G T 17: 72,057,471 (GRCm39) F735L probably damaging Het
Pdzrn4 A G 15: 92,655,538 (GRCm39) E477G possibly damaging Het
Rab5b C T 10: 128,518,772 (GRCm39) R120Q probably benign Het
Rims2 G T 15: 39,326,011 (GRCm39) probably null Het
Samd4b C T 7: 28,122,873 (GRCm39) A62T probably damaging Het
Scamp1 T C 13: 94,347,088 (GRCm39) N192S probably benign Het
Scnn1g T C 7: 121,345,802 (GRCm39) probably benign Het
Setd1a T G 7: 127,387,358 (GRCm39) probably benign Het
Setdb1 A G 3: 95,257,192 (GRCm39) probably benign Het
Slc2a7 T C 4: 150,250,823 (GRCm39) S415P probably benign Het
Sp140l2 G T 1: 85,247,824 (GRCm39) probably benign Het
Strip2 A T 6: 29,937,650 (GRCm39) Y526F possibly damaging Het
Styxl2 T A 1: 165,928,332 (GRCm39) T427S probably benign Het
Syne2 A G 12: 75,926,951 (GRCm39) D69G probably damaging Het
Syt13 C A 2: 92,745,596 (GRCm39) A22E probably benign Het
Tm9sf2 T C 14: 122,392,780 (GRCm39) F432S probably benign Het
Vmn2r49 A T 7: 9,710,357 (GRCm39) W792R probably damaging Het
Zfp292 T C 4: 34,808,227 (GRCm39) S1606G probably benign Het
Zfp518a A T 19: 40,900,665 (GRCm39) H198L probably damaging Het
Other mutations in Kcnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Kcnt1 APN 2 25,782,419 (GRCm39) missense probably damaging 0.98
IGL01358:Kcnt1 APN 2 25,806,017 (GRCm39) missense probably damaging 1.00
IGL01593:Kcnt1 APN 2 25,788,766 (GRCm39) missense probably damaging 1.00
IGL01779:Kcnt1 APN 2 25,790,979 (GRCm39) missense probably damaging 1.00
IGL01800:Kcnt1 APN 2 25,778,137 (GRCm39) missense probably damaging 1.00
IGL01834:Kcnt1 APN 2 25,802,731 (GRCm39) critical splice donor site probably null
IGL02001:Kcnt1 APN 2 25,798,164 (GRCm39) missense probably damaging 1.00
IGL02061:Kcnt1 APN 2 25,790,494 (GRCm39) critical splice donor site probably null
IGL02121:Kcnt1 APN 2 25,791,877 (GRCm39) missense probably damaging 1.00
IGL02646:Kcnt1 APN 2 25,790,892 (GRCm39) splice site probably benign
IGL02683:Kcnt1 APN 2 25,790,937 (GRCm39) missense possibly damaging 0.85
IGL03028:Kcnt1 APN 2 25,799,215 (GRCm39) critical splice acceptor site probably null
IGL03139:Kcnt1 APN 2 25,784,480 (GRCm39) splice site probably benign
R0070:Kcnt1 UTSW 2 25,782,374 (GRCm39) missense probably benign 0.00
R0070:Kcnt1 UTSW 2 25,782,374 (GRCm39) missense probably benign 0.00
R0149:Kcnt1 UTSW 2 25,788,276 (GRCm39) splice site probably benign
R0294:Kcnt1 UTSW 2 25,778,122 (GRCm39) missense probably damaging 0.99
R0481:Kcnt1 UTSW 2 25,782,508 (GRCm39) missense probably damaging 0.98
R0666:Kcnt1 UTSW 2 25,781,255 (GRCm39) splice site probably benign
R1364:Kcnt1 UTSW 2 25,798,106 (GRCm39) missense probably damaging 0.99
R1553:Kcnt1 UTSW 2 25,790,397 (GRCm39) missense probably damaging 1.00
R1916:Kcnt1 UTSW 2 25,790,481 (GRCm39) missense probably damaging 1.00
R1999:Kcnt1 UTSW 2 25,782,372 (GRCm39) missense probably benign
R2079:Kcnt1 UTSW 2 25,790,260 (GRCm39) missense possibly damaging 0.48
R2166:Kcnt1 UTSW 2 25,781,195 (GRCm39) splice site probably benign
R2295:Kcnt1 UTSW 2 25,790,933 (GRCm39) missense probably damaging 1.00
R3688:Kcnt1 UTSW 2 25,784,371 (GRCm39) missense probably damaging 1.00
R3820:Kcnt1 UTSW 2 25,790,904 (GRCm39) missense probably damaging 1.00
R3826:Kcnt1 UTSW 2 25,805,880 (GRCm39) critical splice donor site probably null
R3980:Kcnt1 UTSW 2 25,783,226 (GRCm39) missense possibly damaging 0.91
R4031:Kcnt1 UTSW 2 25,806,060 (GRCm39) missense possibly damaging 0.77
R4093:Kcnt1 UTSW 2 25,767,927 (GRCm39) missense probably damaging 0.99
R4361:Kcnt1 UTSW 2 25,768,044 (GRCm39) missense probably benign 0.03
R4367:Kcnt1 UTSW 2 25,797,638 (GRCm39) missense probably damaging 1.00
R4850:Kcnt1 UTSW 2 25,798,112 (GRCm39) missense probably damaging 1.00
R5005:Kcnt1 UTSW 2 25,791,358 (GRCm39) missense probably damaging 1.00
R5119:Kcnt1 UTSW 2 25,799,334 (GRCm39) intron probably benign
R5223:Kcnt1 UTSW 2 25,793,434 (GRCm39) missense probably benign
R5243:Kcnt1 UTSW 2 25,798,086 (GRCm39) missense probably damaging 1.00
R5323:Kcnt1 UTSW 2 25,799,289 (GRCm39) missense possibly damaging 0.59
R5665:Kcnt1 UTSW 2 25,791,921 (GRCm39) nonsense probably null
R5888:Kcnt1 UTSW 2 25,798,122 (GRCm39) missense probably damaging 1.00
R5906:Kcnt1 UTSW 2 25,788,413 (GRCm39) missense probably damaging 1.00
R5906:Kcnt1 UTSW 2 25,784,536 (GRCm39) intron probably benign
R5927:Kcnt1 UTSW 2 25,799,388 (GRCm39) intron probably benign
R6160:Kcnt1 UTSW 2 25,782,395 (GRCm39) missense probably damaging 0.96
R6161:Kcnt1 UTSW 2 25,793,397 (GRCm39) missense probably benign 0.00
R6179:Kcnt1 UTSW 2 25,783,192 (GRCm39) missense probably damaging 1.00
R6222:Kcnt1 UTSW 2 25,782,522 (GRCm39) missense probably damaging 1.00
R6268:Kcnt1 UTSW 2 25,793,609 (GRCm39) splice site probably null
R6336:Kcnt1 UTSW 2 25,778,767 (GRCm39) splice site probably null
R6395:Kcnt1 UTSW 2 25,799,251 (GRCm39) missense possibly damaging 0.81
R6564:Kcnt1 UTSW 2 25,801,063 (GRCm39) missense probably benign 0.09
R6944:Kcnt1 UTSW 2 25,767,840 (GRCm39) intron probably benign
R7236:Kcnt1 UTSW 2 25,799,951 (GRCm39) splice site probably null
R7308:Kcnt1 UTSW 2 25,790,475 (GRCm39) missense possibly damaging 0.74
R7346:Kcnt1 UTSW 2 25,753,855 (GRCm39) unclassified probably benign
R7419:Kcnt1 UTSW 2 25,806,011 (GRCm39) missense probably benign 0.11
R7461:Kcnt1 UTSW 2 25,791,358 (GRCm39) missense probably benign 0.01
R7470:Kcnt1 UTSW 2 25,799,845 (GRCm39) missense probably damaging 0.96
R7566:Kcnt1 UTSW 2 25,806,048 (GRCm39) missense probably benign 0.31
R7613:Kcnt1 UTSW 2 25,791,358 (GRCm39) missense probably benign 0.01
R7778:Kcnt1 UTSW 2 25,791,901 (GRCm39) missense probably benign 0.10
R8031:Kcnt1 UTSW 2 25,798,054 (GRCm39) splice site probably benign
R8088:Kcnt1 UTSW 2 25,784,326 (GRCm39) missense possibly damaging 0.63
R8113:Kcnt1 UTSW 2 25,791,223 (GRCm39) missense possibly damaging 0.67
R8378:Kcnt1 UTSW 2 25,797,283 (GRCm39) missense probably benign 0.03
R8954:Kcnt1 UTSW 2 25,784,338 (GRCm39) missense probably benign
R9231:Kcnt1 UTSW 2 25,801,074 (GRCm39) missense probably benign 0.00
R9445:Kcnt1 UTSW 2 25,767,959 (GRCm39) missense probably damaging 1.00
R9733:Kcnt1 UTSW 2 25,797,351 (GRCm39) missense probably benign 0.00
Z1176:Kcnt1 UTSW 2 25,796,808 (GRCm39) missense probably benign 0.07
Z1177:Kcnt1 UTSW 2 25,799,277 (GRCm39) nonsense probably null
Z1177:Kcnt1 UTSW 2 25,791,240 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGAGCAGTTGGTCCCAATCCAGG -3'
(R):5'- CTGCATGAACCGCATGTTGGAAG -3'

Sequencing Primer
(F):5'- TCCCAATCCAGGGGAAGG -3'
(R):5'- GGTCCCATAGTCATAGAAGTGTAGTC -3'
Posted On 2013-04-24