Incidental Mutation 'R0367:Limch1'
ID30267
Institutional Source Beutler Lab
Gene Symbol Limch1
Ensembl Gene ENSMUSG00000037736
Gene NameLIM and calponin homology domains 1
Synonyms3732412D22Rik
MMRRC Submission 038573-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R0367 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location66745827-67057158 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 66857954 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000101164] [ENSMUST00000101164] [ENSMUST00000117601] [ENSMUST00000118242] [ENSMUST00000118242] [ENSMUST00000130228]
Predicted Effect probably null
Transcript: ENSMUST00000101164
SMART Domains Protein: ENSMUSP00000098723
Gene: ENSMUSG00000037736

DomainStartEndE-ValueType
CH 23 124 2.09e-13 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
coiled coil region 348 397 N/A INTRINSIC
low complexity region 567 586 N/A INTRINSIC
coiled coil region 771 828 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
LIM 986 1044 5.08e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000101164
SMART Domains Protein: ENSMUSP00000098723
Gene: ENSMUSG00000037736

DomainStartEndE-ValueType
CH 23 124 2.09e-13 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
coiled coil region 348 397 N/A INTRINSIC
low complexity region 567 586 N/A INTRINSIC
coiled coil region 771 828 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
LIM 986 1044 5.08e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117601
SMART Domains Protein: ENSMUSP00000113544
Gene: ENSMUSG00000037736

DomainStartEndE-ValueType
CH 23 124 1e-15 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
coiled coil region 348 397 N/A INTRINSIC
low complexity region 567 586 N/A INTRINSIC
coiled coil region 704 752 N/A INTRINSIC
low complexity region 759 771 N/A INTRINSIC
LIM 910 968 2.4e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118242
SMART Domains Protein: ENSMUSP00000112732
Gene: ENSMUSG00000037736

DomainStartEndE-ValueType
CH 23 124 2.09e-13 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 555 574 N/A INTRINSIC
coiled coil region 782 839 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
LIM 997 1055 5.08e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118242
SMART Domains Protein: ENSMUSP00000112732
Gene: ENSMUSG00000037736

DomainStartEndE-ValueType
CH 23 124 2.09e-13 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 555 574 N/A INTRINSIC
coiled coil region 782 839 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
LIM 997 1055 5.08e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119854
SMART Domains Protein: ENSMUSP00000112651
Gene: ENSMUSG00000037736

DomainStartEndE-ValueType
CH 23 124 2.09e-13 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
Pfam:DUF4757 250 418 5.2e-66 PFAM
low complexity region 567 586 N/A INTRINSIC
coiled coil region 771 828 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 989 1003 N/A INTRINSIC
LIM 1012 1070 5.08e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130228
SMART Domains Protein: ENSMUSP00000116126
Gene: ENSMUSG00000037736

DomainStartEndE-ValueType
Pfam:CH 25 77 2.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201852
Meta Mutation Damage Score 0.9484 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,902,114 S12P probably damaging Het
Alx4 T A 2: 93,668,608 D228E probably damaging Het
Antxr2 T C 5: 98,029,596 E71G probably benign Het
Arhgap19 C A 19: 41,801,978 G17V probably benign Het
BC027072 G T 17: 71,750,476 F735L probably damaging Het
C130026I21Rik G T 1: 85,270,103 probably benign Het
C8a A C 4: 104,862,594 probably null Het
Ccne2 T A 4: 11,201,426 probably benign Het
Cdc42bpg G A 19: 6,311,395 C317Y probably damaging Het
Cend1 C A 7: 141,427,895 R4L probably damaging Het
Cfap44 T C 16: 44,433,476 probably null Het
Cpt1c T C 7: 44,959,575 N774S probably benign Het
Csmd1 C T 8: 15,917,270 D3198N probably damaging Het
Dapk2 C T 9: 66,268,886 S323F probably damaging Het
Ddx60 T G 8: 62,017,749 I1425R possibly damaging Het
Dusp27 T A 1: 166,100,763 T427S probably benign Het
Edem1 T A 6: 108,846,752 Y370N probably damaging Het
Elp5 A G 11: 69,975,141 V103A probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
Fat1 A G 8: 45,024,313 D2132G probably damaging Het
Fat2 A T 11: 55,292,093 probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gp2 C T 7: 119,454,568 D57N probably damaging Het
Gpr161 T C 1: 165,317,236 probably benign Het
Gstcd G A 3: 132,986,377 probably benign Het
Hipk3 A T 2: 104,431,249 C980* probably null Het
Htr2a A T 14: 74,642,209 I93L probably damaging Het
Itpr2 T G 6: 146,234,008 K1775N probably damaging Het
Kcnt1 G A 2: 25,907,628 V864I probably damaging Het
Kcnt2 A T 1: 140,351,225 Y38F probably damaging Het
Lmtk2 C T 5: 144,174,285 R608C possibly damaging Het
Loxhd1 C T 18: 77,425,757 probably benign Het
Lpin2 A T 17: 71,215,022 E17V probably damaging Het
Lrrc34 A T 3: 30,629,993 F342I probably benign Het
Lyzl6 A G 11: 103,636,752 probably null Het
Map3k4 A C 17: 12,258,041 probably benign Het
Mocs3 C T 2: 168,231,682 P350S probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Olfr1263 A C 2: 90,015,772 I281L probably damaging Het
Olfr51 A G 11: 51,007,077 Y35C probably damaging Het
Olfr859 G T 9: 19,808,543 S75I probably damaging Het
Pdzrn4 A G 15: 92,757,657 E477G possibly damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rims2 G T 15: 39,462,615 probably null Het
Samd4b C T 7: 28,423,448 A62T probably damaging Het
Scamp1 T C 13: 94,210,580 N192S probably benign Het
Scnn1g T C 7: 121,746,579 probably benign Het
Setd1a T G 7: 127,788,186 probably benign Het
Setdb1 A G 3: 95,349,881 probably benign Het
Slc2a7 T C 4: 150,166,366 S415P probably benign Het
Strip2 A T 6: 29,937,651 Y526F possibly damaging Het
Syne2 A G 12: 75,880,177 D69G probably damaging Het
Syt13 C A 2: 92,915,251 A22E probably benign Het
Tm9sf2 T C 14: 122,155,368 F432S probably benign Het
Vmn2r49 A T 7: 9,976,430 W792R probably damaging Het
Zfp292 T C 4: 34,808,227 S1606G probably benign Het
Zfp518a A T 19: 40,912,221 H198L probably damaging Het
Other mutations in Limch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Limch1 APN 5 66953679 missense probably damaging 0.99
IGL00644:Limch1 APN 5 67016552 missense probably benign 0.01
IGL00705:Limch1 APN 5 66993153 nonsense probably null
IGL01154:Limch1 APN 5 66745958 nonsense probably null 0.00
IGL01865:Limch1 APN 5 66974580 nonsense probably null
IGL02529:Limch1 APN 5 67002613 missense possibly damaging 0.89
IGL03171:Limch1 APN 5 67034194 missense possibly damaging 0.80
IGL03308:Limch1 APN 5 67002558 missense possibly damaging 0.92
IGL03396:Limch1 APN 5 66953673 missense probably damaging 1.00
R0067:Limch1 UTSW 5 66974622 missense probably damaging 0.99
R0067:Limch1 UTSW 5 66974622 missense probably damaging 0.99
R0114:Limch1 UTSW 5 67036084 intron probably benign
R0129:Limch1 UTSW 5 66959590 missense probably damaging 0.96
R0193:Limch1 UTSW 5 67027539 missense probably damaging 1.00
R0194:Limch1 UTSW 5 66999273 missense probably benign 0.05
R0558:Limch1 UTSW 5 66969155 missense probably damaging 1.00
R0927:Limch1 UTSW 5 66997233 missense probably damaging 1.00
R1190:Limch1 UTSW 5 66969197 missense probably damaging 1.00
R1316:Limch1 UTSW 5 66999243 missense probably damaging 1.00
R1469:Limch1 UTSW 5 66881980 splice site probably benign
R1647:Limch1 UTSW 5 66999256 missense probably damaging 1.00
R1648:Limch1 UTSW 5 66999256 missense probably damaging 1.00
R1944:Limch1 UTSW 5 66999099 missense probably damaging 1.00
R2103:Limch1 UTSW 5 66998729 missense probably benign 0.05
R2126:Limch1 UTSW 5 67029760 missense probably damaging 1.00
R2248:Limch1 UTSW 5 67044399 missense probably damaging 1.00
R2415:Limch1 UTSW 5 66974634 missense probably damaging 1.00
R3762:Limch1 UTSW 5 67028840 missense probably damaging 1.00
R3797:Limch1 UTSW 5 66969079 missense probably damaging 1.00
R4659:Limch1 UTSW 5 67027557 missense probably damaging 1.00
R4773:Limch1 UTSW 5 67027507 missense probably damaging 0.99
R4876:Limch1 UTSW 5 66881927 missense possibly damaging 0.64
R5062:Limch1 UTSW 5 66969235 missense probably damaging 1.00
R5191:Limch1 UTSW 5 67027561 missense probably damaging 1.00
R5202:Limch1 UTSW 5 66993173 missense probably damaging 1.00
R5335:Limch1 UTSW 5 66881957 missense probably damaging 1.00
R5436:Limch1 UTSW 5 66974566 missense possibly damaging 0.72
R5994:Limch1 UTSW 5 66974622 missense probably damaging 1.00
R6049:Limch1 UTSW 5 67030860 missense probably benign 0.32
R6228:Limch1 UTSW 5 67016502 missense probably damaging 1.00
R6547:Limch1 UTSW 5 67028774 missense probably damaging 1.00
R6600:Limch1 UTSW 5 66745938 missense probably benign
R6888:Limch1 UTSW 5 67021926 missense probably benign 0.21
R7111:Limch1 UTSW 5 67025176 intron probably null
R7132:Limch1 UTSW 5 66953685 missense probably damaging 1.00
R7144:Limch1 UTSW 5 67017658 missense probably benign 0.10
R7302:Limch1 UTSW 5 66959599 missense probably benign 0.02
R7341:Limch1 UTSW 5 67034202 missense probably benign 0.06
R7491:Limch1 UTSW 5 67054237 missense probably damaging 0.99
X0022:Limch1 UTSW 5 67021952 missense probably benign 0.00
X0027:Limch1 UTSW 5 67002620 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGCTGACACTTCATGGCCTAAG -3'
(R):5'- ACTGGGACACAAGTTCCCAAGTGG -3'

Sequencing Primer
(F):5'- TTATTTCACCTGATCCACGCAAAG -3'
(R):5'- taggaggcagtggcagg -3'
Posted On2013-04-24