Incidental Mutation 'R0367:Samd4b'
ID30274
Institutional Source Beutler Lab
Gene Symbol Samd4b
Ensembl Gene ENSMUSG00000109336
Gene Namesterile alpha motif domain containing 4B
Synonyms
MMRRC Submission 038573-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.692) question?
Stock #R0367 (G1)
Quality Score183
Status Validated
Chromosome7
Chromosomal Location28399522-28598144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 28423448 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 62 (A62T)
Ref Sequence ENSEMBL: ENSMUSP00000147037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040531] [ENSMUST00000207766] [ENSMUST00000208199]
Predicted Effect probably damaging
Transcript: ENSMUST00000040531
AA Change: A62T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040486
Gene: ENSMUSG00000109336
AA Change: A62T

DomainStartEndE-ValueType
low complexity region 81 90 N/A INTRINSIC
low complexity region 174 190 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 278 290 N/A INTRINSIC
SAM 296 359 1.02e-9 SMART
low complexity region 406 420 N/A INTRINSIC
low complexity region 433 461 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207766
AA Change: A62T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000208199
AA Change: A62T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4988 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,902,114 S12P probably damaging Het
Alx4 T A 2: 93,668,608 D228E probably damaging Het
Antxr2 T C 5: 98,029,596 E71G probably benign Het
Arhgap19 C A 19: 41,801,978 G17V probably benign Het
BC027072 G T 17: 71,750,476 F735L probably damaging Het
C130026I21Rik G T 1: 85,270,103 probably benign Het
C8a A C 4: 104,862,594 probably null Het
Ccne2 T A 4: 11,201,426 probably benign Het
Cdc42bpg G A 19: 6,311,395 C317Y probably damaging Het
Cend1 C A 7: 141,427,895 R4L probably damaging Het
Cfap44 T C 16: 44,433,476 probably null Het
Cpt1c T C 7: 44,959,575 N774S probably benign Het
Csmd1 C T 8: 15,917,270 D3198N probably damaging Het
Dapk2 C T 9: 66,268,886 S323F probably damaging Het
Ddx60 T G 8: 62,017,749 I1425R possibly damaging Het
Dusp27 T A 1: 166,100,763 T427S probably benign Het
Edem1 T A 6: 108,846,752 Y370N probably damaging Het
Elp5 A G 11: 69,975,141 V103A probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
Fat1 A G 8: 45,024,313 D2132G probably damaging Het
Fat2 A T 11: 55,292,093 probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gp2 C T 7: 119,454,568 D57N probably damaging Het
Gpr161 T C 1: 165,317,236 probably benign Het
Gstcd G A 3: 132,986,377 probably benign Het
Hipk3 A T 2: 104,431,249 C980* probably null Het
Htr2a A T 14: 74,642,209 I93L probably damaging Het
Itpr2 T G 6: 146,234,008 K1775N probably damaging Het
Kcnt1 G A 2: 25,907,628 V864I probably damaging Het
Kcnt2 A T 1: 140,351,225 Y38F probably damaging Het
Limch1 G A 5: 66,857,954 probably null Het
Lmtk2 C T 5: 144,174,285 R608C possibly damaging Het
Loxhd1 C T 18: 77,425,757 probably benign Het
Lpin2 A T 17: 71,215,022 E17V probably damaging Het
Lrrc34 A T 3: 30,629,993 F342I probably benign Het
Lyzl6 A G 11: 103,636,752 probably null Het
Map3k4 A C 17: 12,258,041 probably benign Het
Mocs3 C T 2: 168,231,682 P350S probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Olfr1263 A C 2: 90,015,772 I281L probably damaging Het
Olfr51 A G 11: 51,007,077 Y35C probably damaging Het
Olfr859 G T 9: 19,808,543 S75I probably damaging Het
Pdzrn4 A G 15: 92,757,657 E477G possibly damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rims2 G T 15: 39,462,615 probably null Het
Scamp1 T C 13: 94,210,580 N192S probably benign Het
Scnn1g T C 7: 121,746,579 probably benign Het
Setd1a T G 7: 127,788,186 probably benign Het
Setdb1 A G 3: 95,349,881 probably benign Het
Slc2a7 T C 4: 150,166,366 S415P probably benign Het
Strip2 A T 6: 29,937,651 Y526F possibly damaging Het
Syne2 A G 12: 75,880,177 D69G probably damaging Het
Syt13 C A 2: 92,915,251 A22E probably benign Het
Tm9sf2 T C 14: 122,155,368 F432S probably benign Het
Vmn2r49 A T 7: 9,976,430 W792R probably damaging Het
Zfp292 T C 4: 34,808,227 S1606G probably benign Het
Zfp518a A T 19: 40,912,221 H198L probably damaging Het
Other mutations in Samd4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Samd4b APN 7 28401877 missense probably damaging 1.00
IGL00979:Samd4b APN 7 28414213 missense probably damaging 1.00
IGL01336:Samd4b APN 7 28413963 missense probably benign 0.00
IGL01432:Samd4b APN 7 28414066 missense possibly damaging 0.60
IGL01895:Samd4b APN 7 28401909 critical splice acceptor site probably null
IGL02827:Samd4b APN 7 28414121 missense probably damaging 1.00
IGL03077:Samd4b APN 7 28406443 missense probably damaging 0.99
IGL03055:Samd4b UTSW 7 28405546 missense possibly damaging 0.89
R0390:Samd4b UTSW 7 28403977 missense probably benign 0.13
R0440:Samd4b UTSW 7 28408160 missense probably benign 0.45
R0488:Samd4b UTSW 7 28414237 missense probably damaging 1.00
R0798:Samd4b UTSW 7 28401623 splice site probably benign
R1233:Samd4b UTSW 7 28414010 missense probably damaging 0.98
R1234:Samd4b UTSW 7 28414010 missense probably damaging 0.98
R1481:Samd4b UTSW 7 28414010 missense probably damaging 0.98
R1643:Samd4b UTSW 7 28423616 missense probably damaging 1.00
R1675:Samd4b UTSW 7 28414010 missense probably damaging 0.98
R1768:Samd4b UTSW 7 28413892 missense probably benign 0.36
R1801:Samd4b UTSW 7 28407331 splice site probably null
R2831:Samd4b UTSW 7 28403913 missense probably damaging 0.99
R4505:Samd4b UTSW 7 28407500 missense probably benign 0.15
R4507:Samd4b UTSW 7 28407500 missense probably benign 0.15
R4731:Samd4b UTSW 7 28406663 missense probably benign 0.00
R5811:Samd4b UTSW 7 28408020 missense probably damaging 1.00
R6063:Samd4b UTSW 7 28423631 start codon destroyed possibly damaging 0.71
R6114:Samd4b UTSW 7 28522792 unclassified probably null
R6356:Samd4b UTSW 7 28401593 missense probably damaging 1.00
R6467:Samd4b UTSW 7 28401860 missense probably damaging 1.00
R7055:Samd4b UTSW 7 28404033 missense probably benign 0.01
R7191:Samd4b UTSW 7 28414261 missense probably benign 0.18
R7371:Samd4b UTSW 7 28423501 missense probably benign 0.33
R7445:Samd4b UTSW 7 28406456 missense probably benign 0.00
R7543:Samd4b UTSW 7 28414286 missense probably benign 0.02
R7663:Samd4b UTSW 7 28423500 nonsense probably null
R7746:Samd4b UTSW 7 28403903 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTGTGGCCTGAGACCAACC -3'
(R):5'- GCACCATGATGTTCCGAGACCAAG -3'

Sequencing Primer
(F):5'- GAGATCCTCTCCTAGCTGAGTG -3'
(R):5'- AGACCAAGTGGGCATCCTC -3'
Posted On2013-04-24