Incidental Mutation 'R0367:Cpt1c'
ID30275
Institutional Source Beutler Lab
Gene Symbol Cpt1c
Ensembl Gene ENSMUSG00000007783
Gene Namecarnitine palmitoyltransferase 1c
Synonyms9630004I06Rik, CPT I-C
MMRRC Submission 038573-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0367 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44959372-44974851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44959575 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 774 (N774S)
Ref Sequence ENSEMBL: ENSMUSP00000148815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063761] [ENSMUST00000080233] [ENSMUST00000120929] [ENSMUST00000212836]
Predicted Effect probably benign
Transcript: ENSMUST00000063761
AA Change: N774S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069539
Gene: ENSMUSG00000007783
AA Change: N774S

DomainStartEndE-ValueType
Pfam:CPT_N 1 47 2.3e-21 PFAM
transmembrane domain 104 126 N/A INTRINSIC
Pfam:Carn_acyltransf 171 757 7.7e-167 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080233
SMART Domains Protein: ENSMUSP00000079122
Gene: ENSMUSG00000059891

DomainStartEndE-ValueType
Pfam:TSKS 26 525 5.7e-281 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120929
SMART Domains Protein: ENSMUSP00000112673
Gene: ENSMUSG00000059891

DomainStartEndE-ValueType
Pfam:TSKS 26 585 8.1e-297 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212217
Predicted Effect probably benign
Transcript: ENSMUST00000212836
AA Change: N774S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212890
Meta Mutation Damage Score 0.0611 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carnitine/choline acetyltransferase family. The encoded protein regulates the beta-oxidation and transport of long-chain fatty acids into mitochondria, and may play a role in the regulation of feeding behavior and whole-body energy homeostasis. Alternatively spliced transcript variants encoding multiple protein isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted mutations in this gene result in reduced body weight, increases in circulating fatty acid levels and mild insulin resistance. Mice homozygous for a different targeted knock-out exhibit reduced ceramide levels, impaired dendritic spine maturationand impaired spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,902,114 S12P probably damaging Het
Alx4 T A 2: 93,668,608 D228E probably damaging Het
Antxr2 T C 5: 98,029,596 E71G probably benign Het
Arhgap19 C A 19: 41,801,978 G17V probably benign Het
BC027072 G T 17: 71,750,476 F735L probably damaging Het
C130026I21Rik G T 1: 85,270,103 probably benign Het
C8a A C 4: 104,862,594 probably null Het
Ccne2 T A 4: 11,201,426 probably benign Het
Cdc42bpg G A 19: 6,311,395 C317Y probably damaging Het
Cend1 C A 7: 141,427,895 R4L probably damaging Het
Cfap44 T C 16: 44,433,476 probably null Het
Csmd1 C T 8: 15,917,270 D3198N probably damaging Het
Dapk2 C T 9: 66,268,886 S323F probably damaging Het
Ddx60 T G 8: 62,017,749 I1425R possibly damaging Het
Dusp27 T A 1: 166,100,763 T427S probably benign Het
Edem1 T A 6: 108,846,752 Y370N probably damaging Het
Elp5 A G 11: 69,975,141 V103A probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
Fat1 A G 8: 45,024,313 D2132G probably damaging Het
Fat2 A T 11: 55,292,093 probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gp2 C T 7: 119,454,568 D57N probably damaging Het
Gpr161 T C 1: 165,317,236 probably benign Het
Gstcd G A 3: 132,986,377 probably benign Het
Hipk3 A T 2: 104,431,249 C980* probably null Het
Htr2a A T 14: 74,642,209 I93L probably damaging Het
Itpr2 T G 6: 146,234,008 K1775N probably damaging Het
Kcnt1 G A 2: 25,907,628 V864I probably damaging Het
Kcnt2 A T 1: 140,351,225 Y38F probably damaging Het
Limch1 G A 5: 66,857,954 probably null Het
Lmtk2 C T 5: 144,174,285 R608C possibly damaging Het
Loxhd1 C T 18: 77,425,757 probably benign Het
Lpin2 A T 17: 71,215,022 E17V probably damaging Het
Lrrc34 A T 3: 30,629,993 F342I probably benign Het
Lyzl6 A G 11: 103,636,752 probably null Het
Map3k4 A C 17: 12,258,041 probably benign Het
Mocs3 C T 2: 168,231,682 P350S probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Olfr1263 A C 2: 90,015,772 I281L probably damaging Het
Olfr51 A G 11: 51,007,077 Y35C probably damaging Het
Olfr859 G T 9: 19,808,543 S75I probably damaging Het
Pdzrn4 A G 15: 92,757,657 E477G possibly damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rims2 G T 15: 39,462,615 probably null Het
Samd4b C T 7: 28,423,448 A62T probably damaging Het
Scamp1 T C 13: 94,210,580 N192S probably benign Het
Scnn1g T C 7: 121,746,579 probably benign Het
Setd1a T G 7: 127,788,186 probably benign Het
Setdb1 A G 3: 95,349,881 probably benign Het
Slc2a7 T C 4: 150,166,366 S415P probably benign Het
Strip2 A T 6: 29,937,651 Y526F possibly damaging Het
Syne2 A G 12: 75,880,177 D69G probably damaging Het
Syt13 C A 2: 92,915,251 A22E probably benign Het
Tm9sf2 T C 14: 122,155,368 F432S probably benign Het
Vmn2r49 A T 7: 9,976,430 W792R probably damaging Het
Zfp292 T C 4: 34,808,227 S1606G probably benign Het
Zfp518a A T 19: 40,912,221 H198L probably damaging Het
Other mutations in Cpt1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Cpt1c APN 7 44960909 missense probably damaging 0.98
IGL01111:Cpt1c APN 7 44965554 missense possibly damaging 0.90
IGL01153:Cpt1c APN 7 44966668 missense probably damaging 0.99
IGL02232:Cpt1c APN 7 44960156 missense probably damaging 0.99
R0046:Cpt1c UTSW 7 44959832 splice site probably benign
R0046:Cpt1c UTSW 7 44959832 splice site probably benign
R0141:Cpt1c UTSW 7 44966671 missense probably damaging 1.00
R0749:Cpt1c UTSW 7 44962826 missense probably damaging 1.00
R1384:Cpt1c UTSW 7 44960924 splice site probably benign
R1611:Cpt1c UTSW 7 44960112 missense probably benign 0.03
R3122:Cpt1c UTSW 7 44959921 missense probably damaging 1.00
R4892:Cpt1c UTSW 7 44959588 missense probably benign 0.14
R5175:Cpt1c UTSW 7 44971357 missense probably damaging 1.00
R6029:Cpt1c UTSW 7 44965124 missense probably benign 0.00
R6352:Cpt1c UTSW 7 44966795 critical splice donor site probably null
R6856:Cpt1c UTSW 7 44959918 missense probably damaging 1.00
R7621:Cpt1c UTSW 7 44967092 missense probably damaging 1.00
R7749:Cpt1c UTSW 7 44962265 missense probably benign 0.16
R7966:Cpt1c UTSW 7 44964014 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGAAAAGCACAGTGGATACTGCACC -3'
(R):5'- TGATGTAGCCTCCTCCCTCAGAAC -3'

Sequencing Primer
(F):5'- TCACATCTTTATTACCAGGTGGG -3'
(R):5'- CCTCAGAACTGCCTCCCG -3'
Posted On2013-04-24