Incidental Mutation 'R0367:Scnn1g'
ID 30277
Institutional Source Beutler Lab
Gene Symbol Scnn1g
Ensembl Gene ENSMUSG00000000216
Gene Name sodium channel, nonvoltage-gated 1 gamma
Synonyms ENaC gamma
MMRRC Submission 038573-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.657) question?
Stock # R0367 (G1)
Quality Score 197
Status Validated
Chromosome 7
Chromosomal Location 121734479-121768475 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 121746579 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000221]
AlphaFold Q9WU39
Predicted Effect probably benign
Transcript: ENSMUST00000000221
SMART Domains Protein: ENSMUSP00000000221
Gene: ENSMUSG00000000216

DomainStartEndE-ValueType
Pfam:ASC 32 558 6.4e-91 PFAM
low complexity region 618 631 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene encodes the gamma subunit of the epithelial sodium channel, a member of the amiloride-sensitive sodium channel family of proteins. This channel regulates sodium homeostasis and blood pressure, by controlling sodium transport in the kidney, colon and lung. Proteolytic processing of the encoded protein results in the release of an inhibitory peptide and channel activation. Homozygous knockout mice for this gene exhibit perinatal lethality, likely due to excess serum potassium. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality between 24-36 hours after birth. Newborns exhibit hyperkalemia, clear lung liquid more slowly, and show low urinary potassium and high urinary sodium concentrations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,902,114 S12P probably damaging Het
Alx4 T A 2: 93,668,608 D228E probably damaging Het
Antxr2 T C 5: 98,029,596 E71G probably benign Het
Arhgap19 C A 19: 41,801,978 G17V probably benign Het
BC027072 G T 17: 71,750,476 F735L probably damaging Het
C130026I21Rik G T 1: 85,270,103 probably benign Het
C8a A C 4: 104,862,594 probably null Het
Ccne2 T A 4: 11,201,426 probably benign Het
Cdc42bpg G A 19: 6,311,395 C317Y probably damaging Het
Cend1 C A 7: 141,427,895 R4L probably damaging Het
Cfap44 T C 16: 44,433,476 probably null Het
Cpt1c T C 7: 44,959,575 N774S probably benign Het
Csmd1 C T 8: 15,917,270 D3198N probably damaging Het
Dapk2 C T 9: 66,268,886 S323F probably damaging Het
Ddx60 T G 8: 62,017,749 I1425R possibly damaging Het
Dusp27 T A 1: 166,100,763 T427S probably benign Het
Edem1 T A 6: 108,846,752 Y370N probably damaging Het
Elp5 A G 11: 69,975,141 V103A probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
Fat1 A G 8: 45,024,313 D2132G probably damaging Het
Fat2 A T 11: 55,292,093 probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gp2 C T 7: 119,454,568 D57N probably damaging Het
Gpr161 T C 1: 165,317,236 probably benign Het
Gstcd G A 3: 132,986,377 probably benign Het
Hipk3 A T 2: 104,431,249 C980* probably null Het
Htr2a A T 14: 74,642,209 I93L probably damaging Het
Itpr2 T G 6: 146,234,008 K1775N probably damaging Het
Kcnt1 G A 2: 25,907,628 V864I probably damaging Het
Kcnt2 A T 1: 140,351,225 Y38F probably damaging Het
Limch1 G A 5: 66,857,954 probably null Het
Lmtk2 C T 5: 144,174,285 R608C possibly damaging Het
Loxhd1 C T 18: 77,425,757 probably benign Het
Lpin2 A T 17: 71,215,022 E17V probably damaging Het
Lrrc34 A T 3: 30,629,993 F342I probably benign Het
Lyzl6 A G 11: 103,636,752 probably null Het
Map3k4 A C 17: 12,258,041 probably benign Het
Mocs3 C T 2: 168,231,682 P350S probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Olfr1263 A C 2: 90,015,772 I281L probably damaging Het
Olfr51 A G 11: 51,007,077 Y35C probably damaging Het
Olfr859 G T 9: 19,808,543 S75I probably damaging Het
Pdzrn4 A G 15: 92,757,657 E477G possibly damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rims2 G T 15: 39,462,615 probably null Het
Samd4b C T 7: 28,423,448 A62T probably damaging Het
Scamp1 T C 13: 94,210,580 N192S probably benign Het
Setd1a T G 7: 127,788,186 probably benign Het
Setdb1 A G 3: 95,349,881 probably benign Het
Slc2a7 T C 4: 150,166,366 S415P probably benign Het
Strip2 A T 6: 29,937,651 Y526F possibly damaging Het
Syne2 A G 12: 75,880,177 D69G probably damaging Het
Syt13 C A 2: 92,915,251 A22E probably benign Het
Tm9sf2 T C 14: 122,155,368 F432S probably benign Het
Vmn2r49 A T 7: 9,976,430 W792R probably damaging Het
Zfp292 T C 4: 34,808,227 S1606G probably benign Het
Zfp518a A T 19: 40,912,221 H198L probably damaging Het
Other mutations in Scnn1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Scnn1g APN 7 121740437 missense probably benign 0.00
IGL01824:Scnn1g APN 7 121766293 missense probably benign 0.00
IGL02133:Scnn1g APN 7 121743699 missense probably damaging 1.00
IGL02529:Scnn1g APN 7 121742446 splice site probably benign
IGL02814:Scnn1g APN 7 121740365 missense probably damaging 1.00
IGL03091:Scnn1g APN 7 121746683 missense probably damaging 1.00
IGL03253:Scnn1g APN 7 121737933 nonsense probably null
PIT4504001:Scnn1g UTSW 7 121742331 missense probably benign 0.30
R0230:Scnn1g UTSW 7 121746761 splice site probably benign
R0324:Scnn1g UTSW 7 121740555 missense possibly damaging 0.62
R0534:Scnn1g UTSW 7 121767424 missense probably benign 0.00
R1747:Scnn1g UTSW 7 121760463 missense probably damaging 0.99
R2004:Scnn1g UTSW 7 121738188 nonsense probably null
R2197:Scnn1g UTSW 7 121767296 missense probably damaging 1.00
R4396:Scnn1g UTSW 7 121740427 missense probably benign 0.01
R4804:Scnn1g UTSW 7 121763080 frame shift probably null
R4805:Scnn1g UTSW 7 121746602 missense probably damaging 1.00
R5219:Scnn1g UTSW 7 121766266 missense probably damaging 1.00
R5757:Scnn1g UTSW 7 121738215 missense probably damaging 1.00
R5882:Scnn1g UTSW 7 121767358 missense possibly damaging 0.79
R5910:Scnn1g UTSW 7 121738095 missense probably damaging 0.99
R6381:Scnn1g UTSW 7 121767499 missense probably benign 0.00
R6666:Scnn1g UTSW 7 121767388 missense probably benign 0.00
R6735:Scnn1g UTSW 7 121742263 missense probably benign 0.02
R6813:Scnn1g UTSW 7 121740353 missense probably damaging 1.00
R6860:Scnn1g UTSW 7 121740353 missense probably damaging 1.00
R6887:Scnn1g UTSW 7 121760444 missense probably benign 0.01
R7289:Scnn1g UTSW 7 121738081 nonsense probably null
R7488:Scnn1g UTSW 7 121763434 missense probably benign 0.00
R7630:Scnn1g UTSW 7 121760481 missense probably damaging 1.00
R7888:Scnn1g UTSW 7 121743655 missense probably damaging 0.97
R7917:Scnn1g UTSW 7 121743693 missense probably damaging 1.00
R9051:Scnn1g UTSW 7 121742343 missense possibly damaging 0.86
R9312:Scnn1g UTSW 7 121740595 missense probably benign 0.00
Z1177:Scnn1g UTSW 7 121760475 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTACTCTTAGCCAGCACCGTGAC -3'
(R):5'- GCTGCACCTCCTTAGAGATCATTCC -3'

Sequencing Primer
(F):5'- GTGTGAACCACTACTTTGAACTCG -3'
(R):5'- TTCCAAACAGAATGTGGTCCTC -3'
Posted On 2013-04-24