Mutagenetix > Incidental Mutation

Incidental Mutation 'R0367:Scnn1g'

30277

Institutional Source

Beutler Lab

Gene Symbol

Scnn1g

Ensembl Gene

ENSMUSG00000000216

Gene Name

sodium channel, nonvoltage-gated 1 gamma

Synonyms

ENaC gamma

MMRRC Submission

038573-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.657) question?

Stock #

R0367 (G1)

Quality Score

197

Status

Validated

Chromosome

Chromosomal Location

121734479-121768475 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 121746579 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000000221 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000221]

AlphaFold

Q9WU39

Predicted Effect

probably benign
Transcript: ENSMUST00000000221

SMART Domains

Protein: ENSMUSP00000000221
Gene: ENSMUSG00000000216

Domain	Start	End	E-Value	Type
Pfam:ASC	32	558	6.4e-91	PFAM
low complexity region	618	631	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.8%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: This gene encodes the gamma subunit of the epithelial sodium channel, a member of the amiloride-sensitive sodium channel family of proteins. This channel regulates sodium homeostasis and blood pressure, by controlling sodium transport in the kidney, colon and lung. Proteolytic processing of the encoded protein results in the release of an inhibitory peptide and channel activation. Homozygous knockout mice for this gene exhibit perinatal lethality, likely due to excess serum potassium. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality between 24-36 hours after birth. Newborns exhibit hyperkalemia, clear lung liquid more slowly, and show low urinary potassium and high urinary sodium concentrations. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	G	5: 76,902,114	S12P	probably damaging	Het
Alx4	T	A	2: 93,668,608	D228E	probably damaging	Het
Antxr2	T	C	5: 98,029,596	E71G	probably benign	Het
Arhgap19	C	A	19: 41,801,978	G17V	probably benign	Het
BC027072	G	T	17: 71,750,476	F735L	probably damaging	Het
C130026I21Rik	G	T	1: 85,270,103		probably benign	Het
C8a	A	C	4: 104,862,594		probably null	Het
Ccne2	T	A	4: 11,201,426		probably benign	Het
Cdc42bpg	G	A	19: 6,311,395	C317Y	probably damaging	Het
Cend1	C	A	7: 141,427,895	R4L	probably damaging	Het
Cfap44	T	C	16: 44,433,476		probably null	Het
Cpt1c	T	C	7: 44,959,575	N774S	probably benign	Het
Csmd1	C	T	8: 15,917,270	D3198N	probably damaging	Het
Dapk2	C	T	9: 66,268,886	S323F	probably damaging	Het
Ddx60	T	G	8: 62,017,749	I1425R	possibly damaging	Het
Dusp27	T	A	1: 166,100,763	T427S	probably benign	Het
Edem1	T	A	6: 108,846,752	Y370N	probably damaging	Het
Elp5	A	G	11: 69,975,141	V103A	probably benign	Het
Fads1	C	T	19: 10,183,065	P5L	probably benign	Het
Fat1	A	G	8: 45,024,313	D2132G	probably damaging	Het
Fat2	A	T	11: 55,292,093		probably benign	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gp2	C	T	7: 119,454,568	D57N	probably damaging	Het
Gpr161	T	C	1: 165,317,236		probably benign	Het
Gstcd	G	A	3: 132,986,377		probably benign	Het
Hipk3	A	T	2: 104,431,249	C980*	probably null	Het
Htr2a	A	T	14: 74,642,209	I93L	probably damaging	Het
Itpr2	T	G	6: 146,234,008	K1775N	probably damaging	Het
Kcnt1	G	A	2: 25,907,628	V864I	probably damaging	Het
Kcnt2	A	T	1: 140,351,225	Y38F	probably damaging	Het
Limch1	G	A	5: 66,857,954		probably null	Het
Lmtk2	C	T	5: 144,174,285	R608C	possibly damaging	Het
Loxhd1	C	T	18: 77,425,757		probably benign	Het
Lpin2	A	T	17: 71,215,022	E17V	probably damaging	Het
Lrrc34	A	T	3: 30,629,993	F342I	probably benign	Het
Lyzl6	A	G	11: 103,636,752		probably null	Het
Map3k4	A	C	17: 12,258,041		probably benign	Het
Mocs3	C	T	2: 168,231,682	P350S	probably benign	Het
Myrf	G	C	19: 10,218,162	T428S	probably benign	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Olfr1263	A	C	2: 90,015,772	I281L	probably damaging	Het
Olfr51	A	G	11: 51,007,077	Y35C	probably damaging	Het
Olfr859	G	T	9: 19,808,543	S75I	probably damaging	Het
Pdzrn4	A	G	15: 92,757,657	E477G	possibly damaging	Het
Rab5b	C	T	10: 128,682,903	R120Q	probably benign	Het
Rims2	G	T	15: 39,462,615		probably null	Het
Samd4b	C	T	7: 28,423,448	A62T	probably damaging	Het
Scamp1	T	C	13: 94,210,580	N192S	probably benign	Het
Setd1a	T	G	7: 127,788,186		probably benign	Het
Setdb1	A	G	3: 95,349,881		probably benign	Het
Slc2a7	T	C	4: 150,166,366	S415P	probably benign	Het
Strip2	A	T	6: 29,937,651	Y526F	possibly damaging	Het
Syne2	A	G	12: 75,880,177	D69G	probably damaging	Het
Syt13	C	A	2: 92,915,251	A22E	probably benign	Het
Tm9sf2	T	C	14: 122,155,368	F432S	probably benign	Het
Vmn2r49	A	T	7: 9,976,430	W792R	probably damaging	Het
Zfp292	T	C	4: 34,808,227	S1606G	probably benign	Het
Zfp518a	A	T	19: 40,912,221	H198L	probably damaging	Het

Other mutations in Scnn1g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00819:Scnn1g	APN	7	121740437	missense	probably benign	0.00
IGL01824:Scnn1g	APN	7	121766293	missense	probably benign	0.00
IGL02133:Scnn1g	APN	7	121743699	missense	probably damaging	1.00
IGL02529:Scnn1g	APN	7	121742446	splice site	probably benign
IGL02814:Scnn1g	APN	7	121740365	missense	probably damaging	1.00
IGL03091:Scnn1g	APN	7	121746683	missense	probably damaging	1.00
IGL03253:Scnn1g	APN	7	121737933	nonsense	probably null
PIT4504001:Scnn1g	UTSW	7	121742331	missense	probably benign	0.30
R0230:Scnn1g	UTSW	7	121746761	splice site	probably benign
R0324:Scnn1g	UTSW	7	121740555	missense	possibly damaging	0.62
R0534:Scnn1g	UTSW	7	121767424	missense	probably benign	0.00
R1747:Scnn1g	UTSW	7	121760463	missense	probably damaging	0.99
R2004:Scnn1g	UTSW	7	121738188	nonsense	probably null
R2197:Scnn1g	UTSW	7	121767296	missense	probably damaging	1.00
R4396:Scnn1g	UTSW	7	121740427	missense	probably benign	0.01
R4804:Scnn1g	UTSW	7	121763080	frame shift	probably null
R4805:Scnn1g	UTSW	7	121746602	missense	probably damaging	1.00
R5219:Scnn1g	UTSW	7	121766266	missense	probably damaging	1.00
R5757:Scnn1g	UTSW	7	121738215	missense	probably damaging	1.00
R5882:Scnn1g	UTSW	7	121767358	missense	possibly damaging	0.79
R5910:Scnn1g	UTSW	7	121738095	missense	probably damaging	0.99
R6381:Scnn1g	UTSW	7	121767499	missense	probably benign	0.00
R6666:Scnn1g	UTSW	7	121767388	missense	probably benign	0.00
R6735:Scnn1g	UTSW	7	121742263	missense	probably benign	0.02
R6813:Scnn1g	UTSW	7	121740353	missense	probably damaging	1.00
R6860:Scnn1g	UTSW	7	121740353	missense	probably damaging	1.00
R6887:Scnn1g	UTSW	7	121760444	missense	probably benign	0.01
R7289:Scnn1g	UTSW	7	121738081	nonsense	probably null
R7488:Scnn1g	UTSW	7	121763434	missense	probably benign	0.00
R7630:Scnn1g	UTSW	7	121760481	missense	probably damaging	1.00
R7888:Scnn1g	UTSW	7	121743655	missense	probably damaging	0.97
R7917:Scnn1g	UTSW	7	121743693	missense	probably damaging	1.00
R9051:Scnn1g	UTSW	7	121742343	missense	possibly damaging	0.86
R9312:Scnn1g	UTSW	7	121740595	missense	probably benign	0.00
Z1177:Scnn1g	UTSW	7	121760475	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTTACTCTTAGCCAGCACCGTGAC -3'
(R):5'- GCTGCACCTCCTTAGAGATCATTCC -3'

Sequencing Primer
(F):5'- GTGTGAACCACTACTTTGAACTCG -3'
(R):5'- TTCCAAACAGAATGTGGTCCTC -3'

Posted On

2013-04-24