Incidental Mutation 'R0367:Rims2'
ID30293
Institutional Source Beutler Lab
Gene Symbol Rims2
Ensembl Gene ENSMUSG00000037386
Gene Nameregulating synaptic membrane exocytosis 2
Synonyms2810036I15Rik, Syt3-rs, RIM2
MMRRC Submission 038573-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.577) question?
Stock #R0367 (G1)
Quality Score164
Status Validated
Chromosome15
Chromosomal Location39198261-39684372 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to T at 39462615 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000042917] [ENSMUST00000082054] [ENSMUST00000227243]
Predicted Effect probably null
Transcript: ENSMUST00000042917
SMART Domains Protein: ENSMUSP00000048719
Gene: ENSMUSG00000037386

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:FYVE_2 30 154 9.5e-18 PFAM
low complexity region 315 335 N/A INTRINSIC
low complexity region 492 498 N/A INTRINSIC
low complexity region 511 521 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
PDZ 646 725 8.27e-16 SMART
low complexity region 740 748 N/A INTRINSIC
C2 790 897 4.08e-21 SMART
low complexity region 905 919 N/A INTRINSIC
low complexity region 1085 1101 N/A INTRINSIC
low complexity region 1116 1130 N/A INTRINSIC
low complexity region 1208 1238 N/A INTRINSIC
C2 1432 1535 3.78e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000082054
SMART Domains Protein: ENSMUSP00000080711
Gene: ENSMUSG00000037386

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:FYVE_2 76 194 2.2e-11 PFAM
low complexity region 355 375 N/A INTRINSIC
low complexity region 532 538 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
PDZ 686 765 8.27e-16 SMART
low complexity region 780 788 N/A INTRINSIC
C2 830 937 4.08e-21 SMART
low complexity region 945 959 N/A INTRINSIC
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1166 1196 N/A INTRINSIC
C2 1390 1493 3.78e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000227243
Predicted Effect probably null
Transcript: ENSMUST00000227381
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a presynaptic protein that interacts with RAB3, a protein important for normal neurotransmitter release. The encoded protein can also bind several other synaptic proteins, including UNC-13 homolog B, ELKS/Rab6-interacting/CAST family member 1, and synaptotagmin 1. This protein is involved in synaptic membrane exocytosis. Polymorphisms in this gene have been associated with degenerative lumbar scoliosis. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body size, aberrant insulin granule exocytosis, and impaired secretion of hormones associated with glucose homeostasis. Mice homozygous for another knock-out allele show a slightly reduced body size, abnormal maternal behavior and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,902,114 S12P probably damaging Het
Alx4 T A 2: 93,668,608 D228E probably damaging Het
Antxr2 T C 5: 98,029,596 E71G probably benign Het
Arhgap19 C A 19: 41,801,978 G17V probably benign Het
BC027072 G T 17: 71,750,476 F735L probably damaging Het
C130026I21Rik G T 1: 85,270,103 probably benign Het
C8a A C 4: 104,862,594 probably null Het
Ccne2 T A 4: 11,201,426 probably benign Het
Cdc42bpg G A 19: 6,311,395 C317Y probably damaging Het
Cend1 C A 7: 141,427,895 R4L probably damaging Het
Cfap44 T C 16: 44,433,476 probably null Het
Cpt1c T C 7: 44,959,575 N774S probably benign Het
Csmd1 C T 8: 15,917,270 D3198N probably damaging Het
Dapk2 C T 9: 66,268,886 S323F probably damaging Het
Ddx60 T G 8: 62,017,749 I1425R possibly damaging Het
Dusp27 T A 1: 166,100,763 T427S probably benign Het
Edem1 T A 6: 108,846,752 Y370N probably damaging Het
Elp5 A G 11: 69,975,141 V103A probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
Fat1 A G 8: 45,024,313 D2132G probably damaging Het
Fat2 A T 11: 55,292,093 probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gp2 C T 7: 119,454,568 D57N probably damaging Het
Gpr161 T C 1: 165,317,236 probably benign Het
Gstcd G A 3: 132,986,377 probably benign Het
Hipk3 A T 2: 104,431,249 C980* probably null Het
Htr2a A T 14: 74,642,209 I93L probably damaging Het
Itpr2 T G 6: 146,234,008 K1775N probably damaging Het
Kcnt1 G A 2: 25,907,628 V864I probably damaging Het
Kcnt2 A T 1: 140,351,225 Y38F probably damaging Het
Limch1 G A 5: 66,857,954 probably null Het
Lmtk2 C T 5: 144,174,285 R608C possibly damaging Het
Loxhd1 C T 18: 77,425,757 probably benign Het
Lpin2 A T 17: 71,215,022 E17V probably damaging Het
Lrrc34 A T 3: 30,629,993 F342I probably benign Het
Lyzl6 A G 11: 103,636,752 probably null Het
Map3k4 A C 17: 12,258,041 probably benign Het
Mocs3 C T 2: 168,231,682 P350S probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Olfr1263 A C 2: 90,015,772 I281L probably damaging Het
Olfr51 A G 11: 51,007,077 Y35C probably damaging Het
Olfr859 G T 9: 19,808,543 S75I probably damaging Het
Pdzrn4 A G 15: 92,757,657 E477G possibly damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Samd4b C T 7: 28,423,448 A62T probably damaging Het
Scamp1 T C 13: 94,210,580 N192S probably benign Het
Scnn1g T C 7: 121,746,579 probably benign Het
Setd1a T G 7: 127,788,186 probably benign Het
Setdb1 A G 3: 95,349,881 probably benign Het
Slc2a7 T C 4: 150,166,366 S415P probably benign Het
Strip2 A T 6: 29,937,651 Y526F possibly damaging Het
Syne2 A G 12: 75,880,177 D69G probably damaging Het
Syt13 C A 2: 92,915,251 A22E probably benign Het
Tm9sf2 T C 14: 122,155,368 F432S probably benign Het
Vmn2r49 A T 7: 9,976,430 W792R probably damaging Het
Zfp292 T C 4: 34,808,227 S1606G probably benign Het
Zfp518a A T 19: 40,912,221 H198L probably damaging Het
Other mutations in Rims2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Rims2 APN 15 39459615 missense probably benign 0.11
IGL00502:Rims2 APN 15 39506984 missense probably damaging 1.00
IGL00556:Rims2 APN 15 39456674 splice site probably null
IGL00811:Rims2 APN 15 39292149 missense probably damaging 1.00
IGL00827:Rims2 APN 15 39472359 missense probably damaging 0.99
IGL01642:Rims2 APN 15 39457796 missense probably damaging 1.00
IGL02951:Rims2 APN 15 39534938 missense probably damaging 1.00
IGL03009:Rims2 APN 15 39566997 missense possibly damaging 0.85
IGL03080:Rims2 APN 15 39535903 missense probably damaging 1.00
IGL03102:Rims2 APN 15 39459593 missense possibly damaging 0.95
IGL03252:Rims2 APN 15 39452352 missense probably benign
IGL03365:Rims2 APN 15 39476541 missense probably damaging 1.00
IGL03393:Rims2 APN 15 39462613 splice site probably null
IGL03409:Rims2 APN 15 39456733 missense probably damaging 1.00
PIT4486001:Rims2 UTSW 15 39476520 missense possibly damaging 0.67
R0009:Rims2 UTSW 15 39534966 missense probably damaging 0.99
R0009:Rims2 UTSW 15 39534966 missense probably damaging 0.99
R0078:Rims2 UTSW 15 39534855 missense probably benign 0.42
R0401:Rims2 UTSW 15 39509632 splice site probably benign
R0531:Rims2 UTSW 15 39567030 missense probably damaging 1.00
R0791:Rims2 UTSW 15 39679625 splice site probably benign
R0838:Rims2 UTSW 15 39681025 missense probably benign 0.02
R1201:Rims2 UTSW 15 39616324 missense possibly damaging 0.91
R1318:Rims2 UTSW 15 39517826 missense probably damaging 0.99
R1457:Rims2 UTSW 15 39511314 missense possibly damaging 0.63
R1619:Rims2 UTSW 15 39506986 missense probably damaging 1.00
R1672:Rims2 UTSW 15 39292189 missense probably benign 0.09
R1743:Rims2 UTSW 15 39679650 missense probably benign 0.10
R1766:Rims2 UTSW 15 39462580 missense probably damaging 0.99
R1779:Rims2 UTSW 15 39681702 missense probably damaging 1.00
R1804:Rims2 UTSW 15 39437043 nonsense probably null
R1985:Rims2 UTSW 15 39345314 missense probably damaging 0.99
R1986:Rims2 UTSW 15 39345314 missense probably damaging 0.99
R2113:Rims2 UTSW 15 39511326 missense probably benign 0.17
R2260:Rims2 UTSW 15 39478566 nonsense probably null
R2510:Rims2 UTSW 15 39585652 missense probably damaging 1.00
R3693:Rims2 UTSW 15 39478575 missense probably benign 0.01
R3937:Rims2 UTSW 15 39437845 missense probably damaging 1.00
R4425:Rims2 UTSW 15 39437924 critical splice donor site probably null
R4453:Rims2 UTSW 15 39292208 missense probably damaging 1.00
R4474:Rims2 UTSW 15 39462560 missense probably damaging 1.00
R4518:Rims2 UTSW 15 39437526 missense probably damaging 1.00
R4526:Rims2 UTSW 15 39437717 missense probably damaging 1.00
R4833:Rims2 UTSW 15 39535914 missense probably damaging 0.98
R4936:Rims2 UTSW 15 39437728 missense probably damaging 1.00
R4993:Rims2 UTSW 15 39454445 missense possibly damaging 0.90
R5001:Rims2 UTSW 15 39452428 missense probably benign 0.03
R5054:Rims2 UTSW 15 39517869 intron probably null
R5072:Rims2 UTSW 15 39462590 missense probably benign 0.01
R5171:Rims2 UTSW 15 39437103 missense probably damaging 1.00
R5429:Rims2 UTSW 15 39345355 missense probably damaging 1.00
R5623:Rims2 UTSW 15 39478615 missense probably damaging 1.00
R5624:Rims2 UTSW 15 39345413 missense possibly damaging 0.46
R5685:Rims2 UTSW 15 39437206 missense possibly damaging 0.67
R5784:Rims2 UTSW 15 39535987 splice site probably null
R5790:Rims2 UTSW 15 39681045 missense probably damaging 1.00
R5822:Rims2 UTSW 15 39476490 missense probably damaging 1.00
R5963:Rims2 UTSW 15 39437182 missense probably damaging 1.00
R5988:Rims2 UTSW 15 39292182 missense probably damaging 1.00
R6057:Rims2 UTSW 15 39675020 missense probably damaging 1.00
R6239:Rims2 UTSW 15 39198363 start codon destroyed unknown
R6407:Rims2 UTSW 15 39452328 missense probably damaging 1.00
R6418:Rims2 UTSW 15 39509696 missense probably damaging 1.00
R6495:Rims2 UTSW 15 39517812 missense probably benign 0.01
R6502:Rims2 UTSW 15 39534855 missense probably benign 0.42
R6753:Rims2 UTSW 15 39566973 missense possibly damaging 0.74
R6855:Rims2 UTSW 15 39345515 missense probably benign 0.06
R6948:Rims2 UTSW 15 39511341 missense probably benign
R7058:Rims2 UTSW 15 39585648 missense probably damaging 1.00
R7167:Rims2 UTSW 15 39437077 missense probably benign
R7217:Rims2 UTSW 15 39476489 missense probably damaging 0.99
R7223:Rims2 UTSW 15 39437032 missense probably benign 0.30
R7289:Rims2 UTSW 15 39437718 missense probably benign 0.00
R7459:Rims2 UTSW 15 39517839 missense probably benign
R7663:Rims2 UTSW 15 39507026 missense probably damaging 1.00
R7792:Rims2 UTSW 15 39198528 missense possibly damaging 0.69
X0034:Rims2 UTSW 15 39437534 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCGTTTAAAGAAGCCTGTTGAGCATTC -3'
(R):5'- TCACCCCAACTTCTGAAAGTGTGATG -3'

Sequencing Primer
(F):5'- CCTGTTGAGCATTCTAAAATAGGAAG -3'
(R):5'- GATTAAAAGAGGGGTTACATATCGTC -3'
Posted On2013-04-24