Incidental Mutation 'R0368:Smox'
ID30310
Institutional Source Beutler Lab
Gene Symbol Smox
Ensembl Gene ENSMUSG00000027333
Gene Namespermine oxidase
SynonymsSMO, B130066H01Rik
MMRRC Submission 038574-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R0368 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location131491496-131525922 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 131522158 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 320 (S320N)
Ref Sequence ENSEMBL: ENSMUSP00000105810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028806] [ENSMUST00000110179] [ENSMUST00000110180] [ENSMUST00000110181] [ENSMUST00000110182] [ENSMUST00000110183] [ENSMUST00000110186] [ENSMUST00000110188] [ENSMUST00000110189] [ENSMUST00000129143] [ENSMUST00000183575] [ENSMUST00000183947]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028806
AA Change: S490N

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028806
Gene: ENSMUSG00000027333
AA Change: S490N

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 7.2e-8 PFAM
Pfam:DAO 26 194 2.5e-9 PFAM
Pfam:NAD_binding_8 29 96 3.8e-18 PFAM
Pfam:Amino_oxidase 34 275 4.2e-27 PFAM
Pfam:Amino_oxidase 302 544 3.4e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110179
AA Change: V237M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105808
Gene: ENSMUSG00000027333
AA Change: V237M

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 2.3e-8 PFAM
Pfam:DAO 26 206 4.2e-10 PFAM
Pfam:Pyr_redox_3 28 101 2.3e-8 PFAM
Pfam:NAD_binding_8 29 96 1e-18 PFAM
Pfam:Amino_oxidase 34 118 6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110180
AA Change: S354N

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105809
Gene: ENSMUSG00000027333
AA Change: S354N

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 5e-8 PFAM
Pfam:DAO 26 196 1.5e-9 PFAM
Pfam:NAD_binding_8 29 96 2.5e-18 PFAM
Pfam:Amino_oxidase 34 272 2.2e-27 PFAM
Pfam:Amino_oxidase 277 408 3.8e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110181
AA Change: S320N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105810
Gene: ENSMUSG00000027333
AA Change: S320N

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 3.6e-8 PFAM
Pfam:DAO 26 202 8.9e-10 PFAM
Pfam:NAD_binding_8 29 96 1.2e-18 PFAM
Pfam:Amino_oxidase 34 116 2.1e-22 PFAM
Pfam:Amino_oxidase 197 374 1.3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110182
SMART Domains Protein: ENSMUSP00000105811
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_3 24 79 1.2e-6 PFAM
Pfam:FAD_binding_2 26 87 1.6e-8 PFAM
Pfam:DAO 26 183 2.9e-9 PFAM
Pfam:Pyr_redox_3 28 103 1.4e-8 PFAM
Pfam:NAD_binding_8 29 96 6.3e-19 PFAM
Pfam:Amino_oxidase 34 118 3.6e-23 PFAM
Pfam:Amino_oxidase 129 179 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110183
SMART Domains Protein: ENSMUSP00000105812
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 2.3e-8 PFAM
Pfam:DAO 26 227 5.1e-10 PFAM
Pfam:Pyr_redox_3 28 103 2.2e-8 PFAM
Pfam:NAD_binding_8 29 96 1.1e-18 PFAM
Pfam:Amino_oxidase 34 118 6.2e-23 PFAM
Pfam:Amino_oxidase 141 237 4.5e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110186
AA Change: S490N

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105815
Gene: ENSMUSG00000027333
AA Change: S490N

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 78 1.7e-7 PFAM
Pfam:DAO 26 132 7.9e-9 PFAM
Pfam:NAD_binding_8 29 95 5.6e-18 PFAM
Pfam:Amino_oxidase 34 275 2.9e-28 PFAM
Pfam:Amino_oxidase 304 574 2.5e-50 PFAM
Predicted Effect silent
Transcript: ENSMUST00000110188
SMART Domains Protein: ENSMUSP00000105817
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 6.9e-8 PFAM
Pfam:DAO 26 194 2.4e-9 PFAM
Pfam:NAD_binding_8 29 96 3.6e-18 PFAM
Pfam:Amino_oxidase 34 275 3.8e-27 PFAM
Pfam:Amino_oxidase 302 463 2.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110189
SMART Domains Protein: ENSMUSP00000105818
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 6.5e-8 PFAM
Pfam:DAO 26 194 2.2e-9 PFAM
Pfam:NAD_binding_8 29 96 3.4e-18 PFAM
Pfam:Amino_oxidase 34 275 3.5e-27 PFAM
Pfam:Amino_oxidase 302 462 5.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129143
SMART Domains Protein: ENSMUSP00000120237
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_3 24 79 9.3e-7 PFAM
Pfam:FAD_binding_2 26 86 8.9e-9 PFAM
Pfam:DAO 26 190 1.6e-10 PFAM
Pfam:Pyr_redox_3 28 102 9.5e-9 PFAM
Pfam:NAD_binding_8 29 96 2.7e-19 PFAM
Pfam:Amino_oxidase 34 118 6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151627
Predicted Effect probably benign
Transcript: ENSMUST00000183575
SMART Domains Protein: ENSMUSP00000139099
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:Thi4 17 73 8.6e-7 PFAM
Pfam:FAD_binding_2 26 75 3.3e-9 PFAM
Pfam:DAO 26 79 4.2e-10 PFAM
Pfam:Pyr_redox 26 79 1.4e-7 PFAM
Pfam:Pyr_redox_3 28 77 2.1e-9 PFAM
Pfam:NAD_binding_8 29 80 6.8e-15 PFAM
Pfam:Amino_oxidase 34 76 3.5e-15 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000183881
AA Change: V61M
Predicted Effect probably benign
Transcript: ENSMUST00000183947
SMART Domains Protein: ENSMUSP00000139278
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_3 24 79 1.4e-6 PFAM
Pfam:FAD_binding_2 26 85 1.8e-8 PFAM
Pfam:DAO 26 200 5e-10 PFAM
Pfam:Pyr_redox_3 28 102 1.7e-8 PFAM
Pfam:NAD_binding_8 29 96 7.7e-19 PFAM
Pfam:Amino_oxidase 34 118 4.4e-23 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyamines are ubiquitous polycationic alkylamines which include spermine, spermidine, putrescine, and agmatine. These molecules participate in a broad range of cellular functions which include cell cycle modulation, scavenging reactive oxygen species, and the control of gene expression. These molecules also play important roles in neurotransmission through their regulation of cell-surface receptor activity, involvement in intracellular signalling pathways, and their putative roles as neurotransmitters. This gene encodes an FAD-containing enzyme that catalyzes the oxidation of spermine to spermadine and secondarily produces hydrogen peroxide. Multiple transcript variants encoding different isoenzymes have been identified for this gene, some of which have failed to demonstrate significant oxidase activity on natural polyamine substrates. The characterized isoenzymes have distinctive biochemical characteristics and substrate specificities, suggesting the existence of additional levels of complexity in polyamine catabolism. [provided by RefSeq, Jul 2012]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A T 19: 9,008,350 K2333* probably null Het
Aox4 C T 1: 58,213,079 L38F probably benign Het
Arhgef15 T C 11: 68,954,693 E111G probably damaging Het
Atp8a2 A T 14: 59,860,212 I789N probably damaging Het
Cdca2 A G 14: 67,700,347 S286P possibly damaging Het
Chrnb1 T A 11: 69,784,757 K457M probably damaging Het
Clec2g A G 6: 128,980,261 I61V possibly damaging Het
Cyb5r3 G A 15: 83,158,792 A233V probably benign Het
Cyp4a10 T A 4: 115,525,377 L278* probably null Het
Dnmt1 T C 9: 20,941,757 E56G probably damaging Het
Fam160b1 A G 19: 57,368,578 T34A possibly damaging Het
Fam166a T A 2: 25,220,673 D164E probably benign Het
Fbln5 A G 12: 101,809,714 probably null Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gabrr3 A G 16: 59,440,596 D289G probably damaging Het
Gpr45 T C 1: 43,033,016 L273P probably damaging Het
Hkdc1 T C 10: 62,411,707 E125G probably null Het
Il25 A G 14: 54,935,174 probably null Het
Itfg1 A T 8: 85,764,407 W298R probably damaging Het
Kank1 A T 19: 25,410,603 K547* probably null Het
Lama5 G A 2: 180,181,230 R2748* probably null Het
Lrp4 C T 2: 91,477,734 T508I probably damaging Het
Map3k10 C T 7: 27,663,360 V434I probably damaging Het
Map3k6 A G 4: 133,252,659 M1265V probably benign Het
Mocs3 C T 2: 168,231,682 P350S probably benign Het
Msh4 T A 3: 153,888,825 Y113F probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nrip1 A G 16: 76,294,016 S218P probably damaging Het
Olfr1281 T C 2: 111,328,787 Y123H probably damaging Het
Olfr1287 T C 2: 111,449,788 I216T probably benign Het
Olig1 C T 16: 91,270,652 S259F probably damaging Het
Osbpl9 A G 4: 109,066,932 V499A probably damaging Het
Pafah2 T C 4: 134,422,491 V371A probably benign Het
Pkp1 T A 1: 135,875,683 M712L probably benign Het
Pkp1 T C 1: 135,886,852 S244G probably benign Het
Ppp1r3a T C 6: 14,718,960 T652A probably benign Het
Rab21 A T 10: 115,298,890 V108E probably damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Scd2 G A 19: 44,301,246 V227I probably benign Het
Sema5b T A 16: 35,628,100 V82E probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Slc13a2 A T 11: 78,404,800 L80* probably null Het
Slc1a5 C T 7: 16,782,178 P93L probably damaging Het
Slc35b2 T C 17: 45,566,463 V172A probably benign Het
Slfn8 A G 11: 83,017,132 L195P probably damaging Het
Sptan1 T C 2: 29,993,915 V589A probably benign Het
Stim2 G A 5: 54,110,140 probably null Het
V1ra8 A G 6: 90,202,962 D49G probably damaging Het
Vmn1r233 A T 17: 20,994,607 V27D possibly damaging Het
Vmn2r98 A T 17: 19,065,827 K196* probably null Het
Wdr77 T C 3: 105,962,066 probably null Het
Other mutations in Smox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Smox APN 2 131512059 missense possibly damaging 0.91
IGL02022:Smox APN 2 131520117 missense probably damaging 0.98
R0411:Smox UTSW 2 131520644 missense probably benign 0.02
R1416:Smox UTSW 2 131522131 missense probably damaging 1.00
R1601:Smox UTSW 2 131520174 missense probably damaging 1.00
R1959:Smox UTSW 2 131520464 missense probably damaging 0.97
R2173:Smox UTSW 2 131512024 missense possibly damaging 0.91
R2215:Smox UTSW 2 131520270 critical splice donor site probably null
R4179:Smox UTSW 2 131524850 missense possibly damaging 0.84
R5282:Smox UTSW 2 131521106 missense probably damaging 0.99
R5630:Smox UTSW 2 131524866 nonsense probably null
R5979:Smox UTSW 2 131516414 missense probably damaging 0.99
R6984:Smox UTSW 2 131522111 missense possibly damaging 0.90
R6986:Smox UTSW 2 131522111 missense possibly damaging 0.90
R7073:Smox UTSW 2 131522111 missense possibly damaging 0.90
R7074:Smox UTSW 2 131522111 missense possibly damaging 0.90
R7183:Smox UTSW 2 131520566 missense possibly damaging 0.91
R8054:Smox UTSW 2 131522180 missense probably benign 0.01
X0026:Smox UTSW 2 131516235 missense probably damaging 1.00
Z1176:Smox UTSW 2 131520541 missense probably damaging 0.98
Z1177:Smox UTSW 2 131512086 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAATACAGCTTGAGTCCAGCCCC -3'
(R):5'- TGCCCTTAGTGAACACTACCCCAG -3'

Sequencing Primer
(F):5'- ATTGTCTTGAAGCCCAGGAG -3'
(R):5'- GCCCTCCTCCCCTGGAC -3'
Posted On2013-04-24