Incidental Mutation 'R0368:Lama5'
ID 30311
Institutional Source Beutler Lab
Gene Symbol Lama5
Ensembl Gene ENSMUSG00000015647
Gene Name laminin, alpha 5
Synonyms
MMRRC Submission 038574-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0368 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 179818166-179867652 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 179823023 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 2748 (R2748*)
Ref Sequence ENSEMBL: ENSMUSP00000015791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015791] [ENSMUST00000061437]
AlphaFold no structure available at present
PDB Structure LAMININ ALPHA5 CHAIN N-TERMINAL FRAGMENT [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000015791
AA Change: R2748*
SMART Domains Protein: ENSMUSP00000015791
Gene: ENSMUSG00000015647
AA Change: R2748*

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
LamNT 44 303 1.06e-132 SMART
EGF_Lam 305 361 4.35e-6 SMART
EGF_Lam 364 431 5.78e-11 SMART
EGF_Lam 434 476 1.32e-5 SMART
EGF_Lam 500 544 8.63e-10 SMART
EGF_Lam 547 590 1.16e-10 SMART
EGF_Lam 593 635 4.63e-10 SMART
EGF_Lam 638 680 6.25e-7 SMART
EGF_Lam 683 726 3.1e-11 SMART
EGF_Lam 730 779 2.99e-4 SMART
EGF_Lam 782 831 4.66e-6 SMART
EGF_Lam 834 878 3.48e-5 SMART
low complexity region 1261 1273 N/A INTRINSIC
EGF_Lam 1443 1486 7.01e-10 SMART
EGF_like 1489 1530 3.64e-1 SMART
EGF_Lam 1533 1579 8.56e-14 SMART
EGF_Lam 1582 1630 1.86e-14 SMART
LamB 1689 1819 5.86e-61 SMART
EGF_like 1818 1862 2.74e0 SMART
EGF_Lam 1865 1912 3.32e-11 SMART
EGF_Lam 1915 1968 1.61e-9 SMART
EGF_Lam 1971 2022 6.39e-13 SMART
EGF_Lam 2025 2069 1.94e-12 SMART
EGF_Lam 2072 2116 1.35e-11 SMART
EGF_like 2103 2145 3.1e1 SMART
EGF_Lam 2119 2166 1.18e-2 SMART
Pfam:Laminin_I 2189 2453 1.7e-65 PFAM
low complexity region 2532 2548 N/A INTRINSIC
low complexity region 2557 2569 N/A INTRINSIC
low complexity region 2632 2641 N/A INTRINSIC
low complexity region 2663 2676 N/A INTRINSIC
LamG 2760 2912 3.97e-8 SMART
LamG 2966 3103 1.78e-10 SMART
LamG 3149 3274 1.11e-20 SMART
LamG 3359 3497 4.05e-23 SMART
LamG 3539 3670 3e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061437
SMART Domains Protein: ENSMUSP00000050076
Gene: ENSMUSG00000039041

DomainStartEndE-ValueType
Pfam:Proteasom_Rpn13 29 111 3.5e-35 PFAM
low complexity region 135 161 N/A INTRINSIC
low complexity region 173 254 N/A INTRINSIC
Pfam:RPN13_C 268 381 7.3e-38 PFAM
low complexity region 390 403 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152850
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the vertebrate laminin alpha chains. Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. The protein encoded by this gene is the alpha-5 subunit of of laminin-10 (laminin-511), laminin-11 (laminin-521) and laminin-15 (laminin-523). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted basal laminae leading to exencephaly, syndactyly, placentopathy, kidney defects, abnormal lobar septation with absence of a visceral pleural membrane, and lethality in late gestation. [provided by MGI curators]
Allele List at MGI

All alleles(49) : Targeted(5) Gene trapped(44)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A T 19: 8,985,714 (GRCm39) K2333* probably null Het
Aox4 C T 1: 58,252,238 (GRCm39) L38F probably benign Het
Arhgef15 T C 11: 68,845,519 (GRCm39) E111G probably damaging Het
Atp8a2 A T 14: 60,097,661 (GRCm39) I789N probably damaging Het
Cdca2 A G 14: 67,937,796 (GRCm39) S286P possibly damaging Het
Chrnb1 T A 11: 69,675,583 (GRCm39) K457M probably damaging Het
Cimip2a T A 2: 25,110,685 (GRCm39) D164E probably benign Het
Clec2g A G 6: 128,957,224 (GRCm39) I61V possibly damaging Het
Cyb5r3 G A 15: 83,042,993 (GRCm39) A233V probably benign Het
Cyp4a10 T A 4: 115,382,574 (GRCm39) L278* probably null Het
Dnmt1 T C 9: 20,853,053 (GRCm39) E56G probably damaging Het
Fbln5 A G 12: 101,775,973 (GRCm39) probably null Het
Fhip2a A G 19: 57,357,010 (GRCm39) T34A possibly damaging Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gabrr3 A G 16: 59,260,959 (GRCm39) D289G probably damaging Het
Gpr45 T C 1: 43,072,176 (GRCm39) L273P probably damaging Het
Hkdc1 T C 10: 62,247,486 (GRCm39) E125G probably null Het
Il25 A G 14: 55,172,631 (GRCm39) probably null Het
Itfg1 A T 8: 86,491,036 (GRCm39) W298R probably damaging Het
Kank1 A T 19: 25,387,967 (GRCm39) K547* probably null Het
Lrp4 C T 2: 91,308,079 (GRCm39) T508I probably damaging Het
Map3k10 C T 7: 27,362,785 (GRCm39) V434I probably damaging Het
Map3k6 A G 4: 132,979,970 (GRCm39) M1265V probably benign Het
Mocs3 C T 2: 168,073,602 (GRCm39) P350S probably benign Het
Msh4 T A 3: 153,594,462 (GRCm39) Y113F probably damaging Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Nrip1 A G 16: 76,090,904 (GRCm39) S218P probably damaging Het
Olig1 C T 16: 91,067,540 (GRCm39) S259F probably damaging Het
Or4k37 T C 2: 111,159,132 (GRCm39) Y123H probably damaging Het
Or4k41 T C 2: 111,280,133 (GRCm39) I216T probably benign Het
Osbpl9 A G 4: 108,924,129 (GRCm39) V499A probably damaging Het
Pafah2 T C 4: 134,149,802 (GRCm39) V371A probably benign Het
Pkp1 T A 1: 135,803,421 (GRCm39) M712L probably benign Het
Pkp1 T C 1: 135,814,590 (GRCm39) S244G probably benign Het
Ppp1r3a T C 6: 14,718,959 (GRCm39) T652A probably benign Het
Rab21 A T 10: 115,134,795 (GRCm39) V108E probably damaging Het
Rab5b C T 10: 128,518,772 (GRCm39) R120Q probably benign Het
Scd2 G A 19: 44,289,685 (GRCm39) V227I probably benign Het
Sema5b T A 16: 35,448,470 (GRCm39) V82E probably damaging Het
Sema6a G A 18: 47,423,112 (GRCm39) probably null Het
Slc13a2 A T 11: 78,295,626 (GRCm39) L80* probably null Het
Slc1a5 C T 7: 16,516,103 (GRCm39) P93L probably damaging Het
Slc35b2 T C 17: 45,877,389 (GRCm39) V172A probably benign Het
Slfn8 A G 11: 82,907,958 (GRCm39) L195P probably damaging Het
Smox G A 2: 131,364,078 (GRCm39) S320N probably damaging Het
Sptan1 T C 2: 29,883,927 (GRCm39) V589A probably benign Het
Stim2 G A 5: 54,267,482 (GRCm39) probably null Het
V1ra8 A G 6: 90,179,944 (GRCm39) D49G probably damaging Het
Vmn1r233 A T 17: 21,214,869 (GRCm39) V27D possibly damaging Het
Vmn2r98 A T 17: 19,286,089 (GRCm39) K196* probably null Het
Wdr77 T C 3: 105,869,382 (GRCm39) probably null Het
Other mutations in Lama5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Lama5 APN 2 179,818,336 (GRCm39) unclassified probably benign
IGL01370:Lama5 APN 2 179,839,193 (GRCm39) missense possibly damaging 0.87
IGL01474:Lama5 APN 2 179,838,363 (GRCm39) missense probably damaging 1.00
IGL01614:Lama5 APN 2 179,822,657 (GRCm39) missense probably damaging 1.00
IGL01941:Lama5 APN 2 179,834,185 (GRCm39) missense possibly damaging 0.71
IGL01953:Lama5 APN 2 179,832,497 (GRCm39) missense probably damaging 0.97
IGL02093:Lama5 APN 2 179,830,380 (GRCm39) missense probably damaging 1.00
IGL02197:Lama5 APN 2 179,849,012 (GRCm39) missense possibly damaging 0.82
IGL02308:Lama5 APN 2 179,832,120 (GRCm39) splice site probably benign
IGL02314:Lama5 APN 2 179,836,275 (GRCm39) splice site probably benign
IGL02317:Lama5 APN 2 179,833,112 (GRCm39) missense probably damaging 1.00
IGL02354:Lama5 APN 2 179,835,677 (GRCm39) nonsense probably null
IGL02361:Lama5 APN 2 179,835,677 (GRCm39) nonsense probably null
IGL02557:Lama5 APN 2 179,832,725 (GRCm39) nonsense probably null
IGL03026:Lama5 APN 2 179,837,760 (GRCm39) missense probably benign 0.34
IGL03160:Lama5 APN 2 179,822,128 (GRCm39) missense probably damaging 1.00
IGL03238:Lama5 APN 2 179,830,367 (GRCm39) missense probably benign
IGL03390:Lama5 APN 2 179,849,011 (GRCm39) missense probably damaging 1.00
blancmange UTSW 2 179,822,404 (GRCm39) missense probably damaging 0.98
cupcake UTSW 2 179,827,752 (GRCm39) missense probably damaging 1.00
layercake UTSW 2 179,822,511 (GRCm39) missense possibly damaging 0.83
poundcake UTSW 2 179,837,401 (GRCm39) missense probably damaging 1.00
Salty UTSW 2 179,823,444 (GRCm39) missense possibly damaging 0.84
PIT4378001:Lama5 UTSW 2 179,831,238 (GRCm39) missense possibly damaging 0.89
R0003:Lama5 UTSW 2 179,819,872 (GRCm39) splice site probably null
R0056:Lama5 UTSW 2 179,828,899 (GRCm39) intron probably benign
R0147:Lama5 UTSW 2 179,832,199 (GRCm39) missense probably benign
R0148:Lama5 UTSW 2 179,832,199 (GRCm39) missense probably benign
R0310:Lama5 UTSW 2 179,823,359 (GRCm39) splice site probably benign
R0326:Lama5 UTSW 2 179,824,219 (GRCm39) missense possibly damaging 0.90
R0479:Lama5 UTSW 2 179,826,250 (GRCm39) missense probably benign 0.03
R0490:Lama5 UTSW 2 179,821,962 (GRCm39) missense possibly damaging 0.90
R0636:Lama5 UTSW 2 179,831,124 (GRCm39) critical splice donor site probably null
R0704:Lama5 UTSW 2 179,821,277 (GRCm39) missense possibly damaging 0.84
R0733:Lama5 UTSW 2 179,822,511 (GRCm39) missense possibly damaging 0.83
R1017:Lama5 UTSW 2 179,837,213 (GRCm39) missense probably damaging 1.00
R1078:Lama5 UTSW 2 179,821,557 (GRCm39) unclassified probably benign
R1294:Lama5 UTSW 2 179,832,714 (GRCm39) missense probably benign 0.00
R1423:Lama5 UTSW 2 179,837,434 (GRCm39) missense probably damaging 1.00
R1438:Lama5 UTSW 2 179,824,593 (GRCm39) missense probably benign 0.01
R1447:Lama5 UTSW 2 179,827,671 (GRCm39) missense probably damaging 0.99
R1540:Lama5 UTSW 2 179,821,944 (GRCm39) missense probably benign
R1601:Lama5 UTSW 2 179,839,538 (GRCm39) missense probably damaging 1.00
R1624:Lama5 UTSW 2 179,848,551 (GRCm39) missense probably benign 0.02
R1674:Lama5 UTSW 2 179,843,780 (GRCm39) missense probably benign 0.00
R1687:Lama5 UTSW 2 179,835,859 (GRCm39) missense probably benign 0.00
R1696:Lama5 UTSW 2 179,844,279 (GRCm39) missense probably damaging 1.00
R1701:Lama5 UTSW 2 179,863,162 (GRCm39) missense probably damaging 1.00
R1778:Lama5 UTSW 2 179,837,274 (GRCm39) splice site probably benign
R1936:Lama5 UTSW 2 179,832,714 (GRCm39) missense probably benign 0.00
R1939:Lama5 UTSW 2 179,832,714 (GRCm39) missense probably benign 0.00
R1940:Lama5 UTSW 2 179,832,714 (GRCm39) missense probably benign 0.00
R1953:Lama5 UTSW 2 179,832,540 (GRCm39) missense possibly damaging 0.94
R1966:Lama5 UTSW 2 179,830,145 (GRCm39) missense probably damaging 1.00
R2024:Lama5 UTSW 2 179,820,923 (GRCm39) missense probably benign 0.00
R2079:Lama5 UTSW 2 179,867,301 (GRCm39) missense possibly damaging 0.68
R2115:Lama5 UTSW 2 179,828,678 (GRCm39) missense probably damaging 1.00
R2173:Lama5 UTSW 2 179,838,035 (GRCm39) missense probably benign 0.00
R2272:Lama5 UTSW 2 179,820,396 (GRCm39) missense possibly damaging 0.93
R2357:Lama5 UTSW 2 179,821,890 (GRCm39) missense probably benign 0.01
R2860:Lama5 UTSW 2 179,829,040 (GRCm39) missense probably benign 0.00
R2861:Lama5 UTSW 2 179,829,040 (GRCm39) missense probably benign 0.00
R2939:Lama5 UTSW 2 179,840,747 (GRCm39) missense probably damaging 1.00
R3053:Lama5 UTSW 2 179,824,860 (GRCm39) missense probably damaging 0.99
R3430:Lama5 UTSW 2 179,838,110 (GRCm39) missense probably benign 0.00
R3752:Lama5 UTSW 2 179,829,015 (GRCm39) missense probably damaging 1.00
R3782:Lama5 UTSW 2 179,836,356 (GRCm39) missense possibly damaging 0.57
R3901:Lama5 UTSW 2 179,824,144 (GRCm39) splice site probably benign
R4248:Lama5 UTSW 2 179,822,220 (GRCm39) missense possibly damaging 0.84
R4626:Lama5 UTSW 2 179,826,253 (GRCm39) missense probably damaging 0.98
R4638:Lama5 UTSW 2 179,832,206 (GRCm39) missense possibly damaging 0.89
R4669:Lama5 UTSW 2 179,822,430 (GRCm39) missense probably damaging 1.00
R4673:Lama5 UTSW 2 179,841,059 (GRCm39) missense probably damaging 1.00
R4677:Lama5 UTSW 2 179,821,159 (GRCm39) missense possibly damaging 0.69
R4701:Lama5 UTSW 2 179,833,489 (GRCm39) missense probably damaging 1.00
R4774:Lama5 UTSW 2 179,827,734 (GRCm39) missense probably damaging 1.00
R4880:Lama5 UTSW 2 179,818,861 (GRCm39) unclassified probably benign
R4923:Lama5 UTSW 2 179,825,942 (GRCm39) missense probably benign 0.18
R4960:Lama5 UTSW 2 179,850,045 (GRCm39) critical splice donor site probably null
R4983:Lama5 UTSW 2 179,835,242 (GRCm39) missense probably benign 0.13
R5061:Lama5 UTSW 2 179,840,579 (GRCm39) nonsense probably null
R5080:Lama5 UTSW 2 179,848,993 (GRCm39) nonsense probably null
R5135:Lama5 UTSW 2 179,844,013 (GRCm39) missense possibly damaging 0.89
R5206:Lama5 UTSW 2 179,833,097 (GRCm39) missense probably damaging 1.00
R5296:Lama5 UTSW 2 179,835,594 (GRCm39) missense probably damaging 1.00
R5319:Lama5 UTSW 2 179,822,911 (GRCm39) missense probably damaging 1.00
R5355:Lama5 UTSW 2 179,823,444 (GRCm39) missense possibly damaging 0.84
R5388:Lama5 UTSW 2 179,832,539 (GRCm39) missense possibly damaging 0.83
R5528:Lama5 UTSW 2 179,836,356 (GRCm39) missense probably benign 0.21
R5536:Lama5 UTSW 2 179,831,142 (GRCm39) missense probably damaging 0.99
R5658:Lama5 UTSW 2 179,850,069 (GRCm39) nonsense probably null
R5823:Lama5 UTSW 2 179,834,285 (GRCm39) missense probably benign 0.04
R5885:Lama5 UTSW 2 179,843,624 (GRCm39) missense probably damaging 1.00
R5889:Lama5 UTSW 2 179,835,467 (GRCm39) intron probably benign
R5912:Lama5 UTSW 2 179,837,268 (GRCm39) missense probably damaging 1.00
R5955:Lama5 UTSW 2 179,839,267 (GRCm39) missense probably damaging 1.00
R6015:Lama5 UTSW 2 179,827,185 (GRCm39) missense probably benign 0.36
R6037:Lama5 UTSW 2 179,848,806 (GRCm39) missense probably damaging 1.00
R6037:Lama5 UTSW 2 179,848,806 (GRCm39) missense probably damaging 1.00
R6191:Lama5 UTSW 2 179,827,752 (GRCm39) missense probably damaging 1.00
R6191:Lama5 UTSW 2 179,822,404 (GRCm39) missense probably damaging 0.98
R6359:Lama5 UTSW 2 179,837,775 (GRCm39) missense probably benign 0.01
R6385:Lama5 UTSW 2 179,838,326 (GRCm39) missense probably damaging 1.00
R6406:Lama5 UTSW 2 179,839,257 (GRCm39) nonsense probably null
R6552:Lama5 UTSW 2 179,822,947 (GRCm39) missense probably damaging 0.98
R6632:Lama5 UTSW 2 179,833,455 (GRCm39) missense probably damaging 1.00
R6633:Lama5 UTSW 2 179,833,455 (GRCm39) missense probably damaging 1.00
R6645:Lama5 UTSW 2 179,821,463 (GRCm39) missense probably damaging 1.00
R6731:Lama5 UTSW 2 179,830,367 (GRCm39) missense probably benign 0.09
R6744:Lama5 UTSW 2 179,833,455 (GRCm39) missense probably damaging 1.00
R6798:Lama5 UTSW 2 179,833,455 (GRCm39) missense probably damaging 1.00
R6799:Lama5 UTSW 2 179,833,455 (GRCm39) missense probably damaging 1.00
R6801:Lama5 UTSW 2 179,833,455 (GRCm39) missense probably damaging 1.00
R6851:Lama5 UTSW 2 179,833,455 (GRCm39) missense probably damaging 1.00
R6869:Lama5 UTSW 2 179,833,455 (GRCm39) missense probably damaging 1.00
R6881:Lama5 UTSW 2 179,833,455 (GRCm39) missense probably damaging 1.00
R6882:Lama5 UTSW 2 179,833,455 (GRCm39) missense probably damaging 1.00
R6884:Lama5 UTSW 2 179,833,455 (GRCm39) missense probably damaging 1.00
R7022:Lama5 UTSW 2 179,822,524 (GRCm39) missense probably damaging 1.00
R7204:Lama5 UTSW 2 179,843,970 (GRCm39) missense probably damaging 1.00
R7207:Lama5 UTSW 2 179,848,877 (GRCm39) missense probably damaging 0.98
R7282:Lama5 UTSW 2 179,843,588 (GRCm39) missense probably damaging 1.00
R7367:Lama5 UTSW 2 179,834,751 (GRCm39) missense probably benign 0.01
R7410:Lama5 UTSW 2 179,844,183 (GRCm39) critical splice donor site probably null
R7699:Lama5 UTSW 2 179,822,654 (GRCm39) missense probably damaging 1.00
R7849:Lama5 UTSW 2 179,843,605 (GRCm39) missense probably damaging 1.00
R7909:Lama5 UTSW 2 179,834,069 (GRCm39) missense possibly damaging 0.95
R7948:Lama5 UTSW 2 179,843,994 (GRCm39) missense probably damaging 1.00
R8153:Lama5 UTSW 2 179,829,724 (GRCm39) missense probably benign 0.37
R8317:Lama5 UTSW 2 179,848,784 (GRCm39) missense probably damaging 1.00
R8351:Lama5 UTSW 2 179,837,401 (GRCm39) missense probably damaging 1.00
R8370:Lama5 UTSW 2 179,843,280 (GRCm39) missense possibly damaging 0.80
R8398:Lama5 UTSW 2 179,838,827 (GRCm39) critical splice donor site probably null
R8401:Lama5 UTSW 2 179,840,580 (GRCm39) missense probably damaging 1.00
R8404:Lama5 UTSW 2 179,837,015 (GRCm39) missense probably damaging 1.00
R8502:Lama5 UTSW 2 179,837,015 (GRCm39) missense probably damaging 1.00
R8694:Lama5 UTSW 2 179,822,677 (GRCm39) missense probably damaging 0.98
R8705:Lama5 UTSW 2 179,820,354 (GRCm39) missense probably damaging 1.00
R8732:Lama5 UTSW 2 179,828,481 (GRCm39) missense probably damaging 1.00
R8755:Lama5 UTSW 2 179,832,714 (GRCm39) missense probably benign 0.00
R8786:Lama5 UTSW 2 179,838,100 (GRCm39) missense probably damaging 1.00
R8926:Lama5 UTSW 2 179,835,783 (GRCm39) missense probably benign 0.08
R8928:Lama5 UTSW 2 179,843,832 (GRCm39) missense probably damaging 1.00
R8953:Lama5 UTSW 2 179,835,313 (GRCm39) missense probably damaging 0.99
R8958:Lama5 UTSW 2 179,835,592 (GRCm39) missense probably benign
R9002:Lama5 UTSW 2 179,838,311 (GRCm39) missense probably damaging 1.00
R9081:Lama5 UTSW 2 179,833,930 (GRCm39) nonsense probably null
R9165:Lama5 UTSW 2 179,821,286 (GRCm39) missense probably damaging 0.99
R9233:Lama5 UTSW 2 179,840,502 (GRCm39) nonsense probably null
R9264:Lama5 UTSW 2 179,838,271 (GRCm39) splice site probably benign
R9311:Lama5 UTSW 2 179,838,275 (GRCm39) critical splice donor site probably null
R9443:Lama5 UTSW 2 179,843,522 (GRCm39) missense probably benign 0.00
R9488:Lama5 UTSW 2 179,823,234 (GRCm39) missense possibly damaging 0.95
R9674:Lama5 UTSW 2 179,840,267 (GRCm39) critical splice donor site probably null
R9684:Lama5 UTSW 2 179,849,038 (GRCm39) missense probably damaging 1.00
R9749:Lama5 UTSW 2 179,825,433 (GRCm39) missense probably benign 0.00
RF020:Lama5 UTSW 2 179,837,971 (GRCm39) missense probably benign
X0065:Lama5 UTSW 2 179,823,524 (GRCm39) missense probably benign 0.26
Z1177:Lama5 UTSW 2 179,832,507 (GRCm39) missense possibly damaging 0.95
Z1177:Lama5 UTSW 2 179,831,212 (GRCm39) missense probably damaging 1.00
Z1177:Lama5 UTSW 2 179,825,423 (GRCm39) missense probably benign 0.03
Z1177:Lama5 UTSW 2 179,840,603 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGTCCGATATAGCCCATTCCC -3'
(R):5'- ACCGTGGAGTTCACAATGCCAG -3'

Sequencing Primer
(F):5'- ATAGCCCATTcccccccc -3'
(R):5'- AATGCCAGCCTGGCTTTG -3'
Posted On 2013-04-24