Incidental Mutation 'R0368:Osbpl9'
ID 30314
Institutional Source Beutler Lab
Gene Symbol Osbpl9
Ensembl Gene ENSMUSG00000028559
Gene Name oxysterol binding protein-like 9
Synonyms ORP-9, 2600011I06Rik
MMRRC Submission 038574-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0368 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 108918342-109059469 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108924129 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 499 (V499A)
Ref Sequence ENSEMBL: ENSMUSP00000030288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030288] [ENSMUST00000084366] [ENSMUST00000159545] [ENSMUST00000160271] [ENSMUST00000160774] [ENSMUST00000162787] [ENSMUST00000194478] [ENSMUST00000161363]
AlphaFold A2A8Z1
Predicted Effect probably damaging
Transcript: ENSMUST00000030288
AA Change: V499A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030288
Gene: ENSMUSG00000028559
AA Change: V499A

DomainStartEndE-ValueType
PH 3 101 8.5e-17 SMART
low complexity region 253 274 N/A INTRINSIC
low complexity region 285 301 N/A INTRINSIC
low complexity region 349 362 N/A INTRINSIC
Pfam:Oxysterol_BP 377 729 7.3e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084366
AA Change: V402A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081396
Gene: ENSMUSG00000028559
AA Change: V402A

DomainStartEndE-ValueType
low complexity region 156 177 N/A INTRINSIC
low complexity region 188 204 N/A INTRINSIC
low complexity region 252 265 N/A INTRINSIC
Pfam:Oxysterol_BP 277 634 7.2e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159198
Predicted Effect probably benign
Transcript: ENSMUST00000159545
SMART Domains Protein: ENSMUSP00000123856
Gene: ENSMUSG00000028559

DomainStartEndE-ValueType
Blast:PH 3 54 6e-33 BLAST
SCOP:d1pls__ 4 46 9e-8 SMART
PDB:2KCJ|A 4 55 1e-10 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000160271
AA Change: V389A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124112
Gene: ENSMUSG00000028559
AA Change: V389A

DomainStartEndE-ValueType
low complexity region 143 164 N/A INTRINSIC
low complexity region 175 191 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
Pfam:Oxysterol_BP 264 621 4.7e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160774
AA Change: V482A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124742
Gene: ENSMUSG00000028559
AA Change: V482A

DomainStartEndE-ValueType
PH 3 84 6.46e-8 SMART
low complexity region 236 257 N/A INTRINSIC
low complexity region 268 284 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
Pfam:Oxysterol_BP 357 714 2.8e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162787
AA Change: V486A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124370
Gene: ENSMUSG00000028559
AA Change: V486A

DomainStartEndE-ValueType
PH 3 101 8.5e-17 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 272 288 N/A INTRINSIC
low complexity region 336 349 N/A INTRINSIC
Pfam:Oxysterol_BP 361 718 2.8e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194478
AA Change: V509A

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141991
Gene: ENSMUSG00000028559
AA Change: V509A

DomainStartEndE-ValueType
PH 3 101 3.7e-19 SMART
low complexity region 263 284 N/A INTRINSIC
low complexity region 295 311 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Pfam:Oxysterol_BP 384 741 2e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161363
AA Change: V419A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125714
Gene: ENSMUSG00000028559
AA Change: V419A

DomainStartEndE-ValueType
Blast:PH 13 34 3e-6 BLAST
low complexity region 173 194 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 269 282 N/A INTRINSIC
Pfam:Oxysterol_BP 294 651 2.2e-82 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain, although some members contain only the sterol-binding domain. This family member functions as a cholesterol transfer protein that regulates Golgi structure and function. Multiple transcript variants, most of which encode distinct isoforms, have been identified. Related pseudogenes have been identified on chromosomes 3, 11 and 12. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A T 19: 8,985,714 (GRCm39) K2333* probably null Het
Aox4 C T 1: 58,252,238 (GRCm39) L38F probably benign Het
Arhgef15 T C 11: 68,845,519 (GRCm39) E111G probably damaging Het
Atp8a2 A T 14: 60,097,661 (GRCm39) I789N probably damaging Het
Cdca2 A G 14: 67,937,796 (GRCm39) S286P possibly damaging Het
Chrnb1 T A 11: 69,675,583 (GRCm39) K457M probably damaging Het
Cimip2a T A 2: 25,110,685 (GRCm39) D164E probably benign Het
Clec2g A G 6: 128,957,224 (GRCm39) I61V possibly damaging Het
Cyb5r3 G A 15: 83,042,993 (GRCm39) A233V probably benign Het
Cyp4a10 T A 4: 115,382,574 (GRCm39) L278* probably null Het
Dnmt1 T C 9: 20,853,053 (GRCm39) E56G probably damaging Het
Fbln5 A G 12: 101,775,973 (GRCm39) probably null Het
Fhip2a A G 19: 57,357,010 (GRCm39) T34A possibly damaging Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gabrr3 A G 16: 59,260,959 (GRCm39) D289G probably damaging Het
Gpr45 T C 1: 43,072,176 (GRCm39) L273P probably damaging Het
Hkdc1 T C 10: 62,247,486 (GRCm39) E125G probably null Het
Il25 A G 14: 55,172,631 (GRCm39) probably null Het
Itfg1 A T 8: 86,491,036 (GRCm39) W298R probably damaging Het
Kank1 A T 19: 25,387,967 (GRCm39) K547* probably null Het
Lama5 G A 2: 179,823,023 (GRCm39) R2748* probably null Het
Lrp4 C T 2: 91,308,079 (GRCm39) T508I probably damaging Het
Map3k10 C T 7: 27,362,785 (GRCm39) V434I probably damaging Het
Map3k6 A G 4: 132,979,970 (GRCm39) M1265V probably benign Het
Mocs3 C T 2: 168,073,602 (GRCm39) P350S probably benign Het
Msh4 T A 3: 153,594,462 (GRCm39) Y113F probably damaging Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Nrip1 A G 16: 76,090,904 (GRCm39) S218P probably damaging Het
Olig1 C T 16: 91,067,540 (GRCm39) S259F probably damaging Het
Or4k37 T C 2: 111,159,132 (GRCm39) Y123H probably damaging Het
Or4k41 T C 2: 111,280,133 (GRCm39) I216T probably benign Het
Pafah2 T C 4: 134,149,802 (GRCm39) V371A probably benign Het
Pkp1 T A 1: 135,803,421 (GRCm39) M712L probably benign Het
Pkp1 T C 1: 135,814,590 (GRCm39) S244G probably benign Het
Ppp1r3a T C 6: 14,718,959 (GRCm39) T652A probably benign Het
Rab21 A T 10: 115,134,795 (GRCm39) V108E probably damaging Het
Rab5b C T 10: 128,518,772 (GRCm39) R120Q probably benign Het
Scd2 G A 19: 44,289,685 (GRCm39) V227I probably benign Het
Sema5b T A 16: 35,448,470 (GRCm39) V82E probably damaging Het
Sema6a G A 18: 47,423,112 (GRCm39) probably null Het
Slc13a2 A T 11: 78,295,626 (GRCm39) L80* probably null Het
Slc1a5 C T 7: 16,516,103 (GRCm39) P93L probably damaging Het
Slc35b2 T C 17: 45,877,389 (GRCm39) V172A probably benign Het
Slfn8 A G 11: 82,907,958 (GRCm39) L195P probably damaging Het
Smox G A 2: 131,364,078 (GRCm39) S320N probably damaging Het
Sptan1 T C 2: 29,883,927 (GRCm39) V589A probably benign Het
Stim2 G A 5: 54,267,482 (GRCm39) probably null Het
V1ra8 A G 6: 90,179,944 (GRCm39) D49G probably damaging Het
Vmn1r233 A T 17: 21,214,869 (GRCm39) V27D possibly damaging Het
Vmn2r98 A T 17: 19,286,089 (GRCm39) K196* probably null Het
Wdr77 T C 3: 105,869,382 (GRCm39) probably null Het
Other mutations in Osbpl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Osbpl9 APN 4 108,929,207 (GRCm39) missense probably damaging 1.00
IGL00793:Osbpl9 APN 4 108,944,628 (GRCm39) missense probably damaging 0.99
IGL00809:Osbpl9 APN 4 108,990,960 (GRCm39) missense probably damaging 1.00
IGL02071:Osbpl9 APN 4 108,929,176 (GRCm39) missense probably damaging 1.00
IGL02547:Osbpl9 APN 4 108,925,680 (GRCm39) nonsense probably null
IGL02822:Osbpl9 APN 4 108,930,118 (GRCm39) missense probably damaging 1.00
IGL03074:Osbpl9 APN 4 108,929,158 (GRCm39) missense probably damaging 1.00
IGL03193:Osbpl9 APN 4 108,924,163 (GRCm39) missense possibly damaging 0.90
IGL03196:Osbpl9 APN 4 108,930,061 (GRCm39) missense probably damaging 1.00
IGL03306:Osbpl9 APN 4 109,029,529 (GRCm39) splice site probably benign
IGL03323:Osbpl9 APN 4 108,919,656 (GRCm39) splice site probably benign
Oblong UTSW 4 108,948,876 (GRCm39) missense possibly damaging 0.62
R0211:Osbpl9 UTSW 4 108,930,321 (GRCm39) missense probably damaging 1.00
R0620:Osbpl9 UTSW 4 108,940,325 (GRCm39) missense probably damaging 1.00
R1439:Osbpl9 UTSW 4 108,958,353 (GRCm39) missense probably damaging 1.00
R1711:Osbpl9 UTSW 4 108,923,415 (GRCm39) missense probably damaging 1.00
R1757:Osbpl9 UTSW 4 108,921,780 (GRCm39) missense probably damaging 1.00
R2237:Osbpl9 UTSW 4 109,013,854 (GRCm39) missense probably damaging 1.00
R2295:Osbpl9 UTSW 4 109,059,331 (GRCm39) missense probably damaging 0.99
R2418:Osbpl9 UTSW 4 108,923,415 (GRCm39) missense probably damaging 1.00
R3111:Osbpl9 UTSW 4 108,940,290 (GRCm39) missense probably benign 0.08
R4202:Osbpl9 UTSW 4 109,029,437 (GRCm39) intron probably benign
R4672:Osbpl9 UTSW 4 108,921,806 (GRCm39) missense possibly damaging 0.82
R4706:Osbpl9 UTSW 4 109,013,884 (GRCm39) missense probably damaging 1.00
R4856:Osbpl9 UTSW 4 108,925,564 (GRCm39) missense probably benign 0.38
R4886:Osbpl9 UTSW 4 108,925,564 (GRCm39) missense probably benign 0.38
R5035:Osbpl9 UTSW 4 108,923,364 (GRCm39) missense probably damaging 0.99
R5309:Osbpl9 UTSW 4 108,923,352 (GRCm39) missense probably damaging 1.00
R5400:Osbpl9 UTSW 4 108,919,497 (GRCm39) nonsense probably null
R5719:Osbpl9 UTSW 4 108,919,763 (GRCm39) nonsense probably null
R5810:Osbpl9 UTSW 4 108,943,571 (GRCm39) missense probably benign 0.00
R6237:Osbpl9 UTSW 4 109,013,899 (GRCm39) missense probably damaging 1.00
R6575:Osbpl9 UTSW 4 108,930,129 (GRCm39) missense possibly damaging 0.89
R6648:Osbpl9 UTSW 4 108,948,876 (GRCm39) missense possibly damaging 0.62
R6675:Osbpl9 UTSW 4 108,991,025 (GRCm39) splice site probably null
R7130:Osbpl9 UTSW 4 108,940,296 (GRCm39) missense probably benign
R7356:Osbpl9 UTSW 4 108,925,677 (GRCm39) nonsense probably null
R7615:Osbpl9 UTSW 4 108,943,536 (GRCm39) missense probably damaging 1.00
R7753:Osbpl9 UTSW 4 108,990,970 (GRCm39) missense possibly damaging 0.86
R7772:Osbpl9 UTSW 4 108,923,384 (GRCm39) missense probably damaging 0.99
R7788:Osbpl9 UTSW 4 108,919,691 (GRCm39) missense probably benign 0.41
R8083:Osbpl9 UTSW 4 108,943,572 (GRCm39) missense possibly damaging 0.74
R8143:Osbpl9 UTSW 4 108,922,906 (GRCm39) missense probably benign 0.12
R8323:Osbpl9 UTSW 4 108,965,119 (GRCm39) missense probably benign 0.01
R8331:Osbpl9 UTSW 4 108,923,378 (GRCm39) missense probably damaging 1.00
R8406:Osbpl9 UTSW 4 108,921,770 (GRCm39) missense possibly damaging 0.82
R8531:Osbpl9 UTSW 4 109,013,908 (GRCm39) missense probably damaging 1.00
R8715:Osbpl9 UTSW 4 108,959,773 (GRCm39) missense probably benign 0.21
R8888:Osbpl9 UTSW 4 108,930,333 (GRCm39) missense probably benign 0.03
R8895:Osbpl9 UTSW 4 108,930,333 (GRCm39) missense probably benign 0.03
R9079:Osbpl9 UTSW 4 108,920,644 (GRCm39) missense possibly damaging 0.48
R9379:Osbpl9 UTSW 4 108,940,399 (GRCm39) missense probably damaging 0.99
R9775:Osbpl9 UTSW 4 109,013,747 (GRCm39) intron probably benign
Z1177:Osbpl9 UTSW 4 108,965,077 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGACAAGTGTTAGTTCCCCACCCC -3'
(R):5'- GGTGCAATGTTCAGTGCATACAAGG -3'

Sequencing Primer
(F):5'- CCCACCCCCTTCATTCTATG -3'
(R):5'- GCTCATGTTAGGTACATGAAGCC -3'
Posted On 2013-04-24