Incidental Mutation 'R0368:Cyp4a10'
ID 30315
Institutional Source Beutler Lab
Gene Symbol Cyp4a10
Ensembl Gene ENSMUSG00000066072
Gene Name cytochrome P450, family 4, subfamily a, polypeptide 10
Synonyms Msp-3, Cyp4a, RP1, D4Rp1
MMRRC Submission 038574-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R0368 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 115375484-115390846 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 115382574 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 278 (L278*)
Ref Sequence ENSEMBL: ENSMUSP00000092486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058785] [ENSMUST00000094886]
AlphaFold O88833
Predicted Effect probably null
Transcript: ENSMUST00000058785
AA Change: L288*
SMART Domains Protein: ENSMUSP00000061126
Gene: ENSMUSG00000066072
AA Change: L288*

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 504 2.3e-133 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000094886
AA Change: L278*
SMART Domains Protein: ENSMUSP00000092486
Gene: ENSMUSG00000066072
AA Change: L278*

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
Pfam:p450 51 494 4.5e-129 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display salt-sensitive hypertension, decrease sodium excretion, and decreased urine output. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A T 19: 8,985,714 (GRCm39) K2333* probably null Het
Aox4 C T 1: 58,252,238 (GRCm39) L38F probably benign Het
Arhgef15 T C 11: 68,845,519 (GRCm39) E111G probably damaging Het
Atp8a2 A T 14: 60,097,661 (GRCm39) I789N probably damaging Het
Cdca2 A G 14: 67,937,796 (GRCm39) S286P possibly damaging Het
Chrnb1 T A 11: 69,675,583 (GRCm39) K457M probably damaging Het
Cimip2a T A 2: 25,110,685 (GRCm39) D164E probably benign Het
Clec2g A G 6: 128,957,224 (GRCm39) I61V possibly damaging Het
Cyb5r3 G A 15: 83,042,993 (GRCm39) A233V probably benign Het
Dnmt1 T C 9: 20,853,053 (GRCm39) E56G probably damaging Het
Fbln5 A G 12: 101,775,973 (GRCm39) probably null Het
Fhip2a A G 19: 57,357,010 (GRCm39) T34A possibly damaging Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gabrr3 A G 16: 59,260,959 (GRCm39) D289G probably damaging Het
Gpr45 T C 1: 43,072,176 (GRCm39) L273P probably damaging Het
Hkdc1 T C 10: 62,247,486 (GRCm39) E125G probably null Het
Il25 A G 14: 55,172,631 (GRCm39) probably null Het
Itfg1 A T 8: 86,491,036 (GRCm39) W298R probably damaging Het
Kank1 A T 19: 25,387,967 (GRCm39) K547* probably null Het
Lama5 G A 2: 179,823,023 (GRCm39) R2748* probably null Het
Lrp4 C T 2: 91,308,079 (GRCm39) T508I probably damaging Het
Map3k10 C T 7: 27,362,785 (GRCm39) V434I probably damaging Het
Map3k6 A G 4: 132,979,970 (GRCm39) M1265V probably benign Het
Mocs3 C T 2: 168,073,602 (GRCm39) P350S probably benign Het
Msh4 T A 3: 153,594,462 (GRCm39) Y113F probably damaging Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Nrip1 A G 16: 76,090,904 (GRCm39) S218P probably damaging Het
Olig1 C T 16: 91,067,540 (GRCm39) S259F probably damaging Het
Or4k37 T C 2: 111,159,132 (GRCm39) Y123H probably damaging Het
Or4k41 T C 2: 111,280,133 (GRCm39) I216T probably benign Het
Osbpl9 A G 4: 108,924,129 (GRCm39) V499A probably damaging Het
Pafah2 T C 4: 134,149,802 (GRCm39) V371A probably benign Het
Pkp1 T A 1: 135,803,421 (GRCm39) M712L probably benign Het
Pkp1 T C 1: 135,814,590 (GRCm39) S244G probably benign Het
Ppp1r3a T C 6: 14,718,959 (GRCm39) T652A probably benign Het
Rab21 A T 10: 115,134,795 (GRCm39) V108E probably damaging Het
Rab5b C T 10: 128,518,772 (GRCm39) R120Q probably benign Het
Scd2 G A 19: 44,289,685 (GRCm39) V227I probably benign Het
Sema5b T A 16: 35,448,470 (GRCm39) V82E probably damaging Het
Sema6a G A 18: 47,423,112 (GRCm39) probably null Het
Slc13a2 A T 11: 78,295,626 (GRCm39) L80* probably null Het
Slc1a5 C T 7: 16,516,103 (GRCm39) P93L probably damaging Het
Slc35b2 T C 17: 45,877,389 (GRCm39) V172A probably benign Het
Slfn8 A G 11: 82,907,958 (GRCm39) L195P probably damaging Het
Smox G A 2: 131,364,078 (GRCm39) S320N probably damaging Het
Sptan1 T C 2: 29,883,927 (GRCm39) V589A probably benign Het
Stim2 G A 5: 54,267,482 (GRCm39) probably null Het
V1ra8 A G 6: 90,179,944 (GRCm39) D49G probably damaging Het
Vmn1r233 A T 17: 21,214,869 (GRCm39) V27D possibly damaging Het
Vmn2r98 A T 17: 19,286,089 (GRCm39) K196* probably null Het
Wdr77 T C 3: 105,869,382 (GRCm39) probably null Het
Other mutations in Cyp4a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00774:Cyp4a10 APN 4 115,389,735 (GRCm39) missense probably damaging 1.00
IGL01301:Cyp4a10 APN 4 115,375,652 (GRCm39) missense probably damaging 1.00
IGL02081:Cyp4a10 APN 4 115,378,369 (GRCm39) missense possibly damaging 0.87
IGL02373:Cyp4a10 APN 4 115,378,274 (GRCm39) nonsense probably null
IGL03411:Cyp4a10 APN 4 115,382,890 (GRCm39) splice site probably null
ANU18:Cyp4a10 UTSW 4 115,375,652 (GRCm39) missense probably damaging 1.00
PIT4142001:Cyp4a10 UTSW 4 115,382,072 (GRCm39) missense probably damaging 0.99
PIT4151001:Cyp4a10 UTSW 4 115,382,072 (GRCm39) missense probably damaging 0.99
R0016:Cyp4a10 UTSW 4 115,378,304 (GRCm39) missense probably damaging 1.00
R1319:Cyp4a10 UTSW 4 115,378,342 (GRCm39) missense probably damaging 0.98
R1440:Cyp4a10 UTSW 4 115,386,646 (GRCm39) missense probably damaging 1.00
R1531:Cyp4a10 UTSW 4 115,375,632 (GRCm39) nonsense probably null
R2008:Cyp4a10 UTSW 4 115,382,589 (GRCm39) missense probably damaging 0.98
R2064:Cyp4a10 UTSW 4 115,381,917 (GRCm39) splice site probably benign
R2083:Cyp4a10 UTSW 4 115,382,505 (GRCm39) missense possibly damaging 0.86
R2961:Cyp4a10 UTSW 4 115,377,467 (GRCm39) missense probably benign 0.02
R3028:Cyp4a10 UTSW 4 115,375,628 (GRCm39) missense possibly damaging 0.64
R3839:Cyp4a10 UTSW 4 115,382,544 (GRCm39) missense possibly damaging 0.85
R3930:Cyp4a10 UTSW 4 115,381,980 (GRCm39) missense probably benign 0.00
R4062:Cyp4a10 UTSW 4 115,376,898 (GRCm39) missense probably benign 0.06
R4097:Cyp4a10 UTSW 4 115,386,480 (GRCm39) missense probably damaging 0.99
R4298:Cyp4a10 UTSW 4 115,389,889 (GRCm39) missense probably damaging 1.00
R4482:Cyp4a10 UTSW 4 115,389,795 (GRCm39) missense probably damaging 1.00
R4592:Cyp4a10 UTSW 4 115,386,690 (GRCm39) missense probably damaging 0.99
R4715:Cyp4a10 UTSW 4 115,382,535 (GRCm39) missense probably benign 0.44
R4826:Cyp4a10 UTSW 4 115,375,541 (GRCm39) missense probably benign 0.00
R4834:Cyp4a10 UTSW 4 115,383,005 (GRCm39) missense probably damaging 1.00
R4922:Cyp4a10 UTSW 4 115,378,291 (GRCm39) missense probably benign 0.01
R5202:Cyp4a10 UTSW 4 115,389,812 (GRCm39) missense probably damaging 1.00
R5502:Cyp4a10 UTSW 4 115,382,702 (GRCm39) missense probably benign 0.21
R6269:Cyp4a10 UTSW 4 115,381,509 (GRCm39) missense probably damaging 1.00
R6349:Cyp4a10 UTSW 4 115,382,555 (GRCm39) missense probably benign 0.00
R7684:Cyp4a10 UTSW 4 115,375,549 (GRCm39) missense probably benign 0.18
R7863:Cyp4a10 UTSW 4 115,375,622 (GRCm39) missense probably benign 0.00
R8392:Cyp4a10 UTSW 4 115,386,675 (GRCm39) nonsense probably null
R8445:Cyp4a10 UTSW 4 115,382,791 (GRCm39) missense probably damaging 1.00
R8744:Cyp4a10 UTSW 4 115,386,667 (GRCm39) missense probably benign 0.00
R9264:Cyp4a10 UTSW 4 115,381,475 (GRCm39) missense probably benign 0.03
R9297:Cyp4a10 UTSW 4 115,378,375 (GRCm39) missense probably damaging 1.00
R9299:Cyp4a10 UTSW 4 115,376,947 (GRCm39) missense probably benign 0.00
R9393:Cyp4a10 UTSW 4 115,382,566 (GRCm39) missense probably damaging 1.00
Z1176:Cyp4a10 UTSW 4 115,375,523 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGCAGAGCTTCCATTGCCC -3'
(R):5'- AGGTCCTTGTCAGACATGCTGTCC -3'

Sequencing Primer
(F):5'- GGTCTGACCTACATCAGATGTCAC -3'
(R):5'- AGACATGCTGTCCCCATTC -3'
Posted On 2013-04-24