Mutagenetix > Incidental Mutation

Incidental Mutation 'R0368:Map3k6'

30316

Institutional Source

Beutler Lab

Gene Symbol

Map3k6

Ensembl Gene

ENSMUSG00000028862

Gene Name

mitogen-activated protein kinase kinase kinase 6

Synonyms

Ask2, MAPKKK6, MEKK6

MMRRC Submission

038574-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.393) question?

Stock #

R0368 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

133240818-133252929 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 133252659 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 1265 (M1265V)

Ref Sequence

ENSEMBL: ENSMUSP00000030677 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030674] [ENSMUST00000030677] [ENSMUST00000105908]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000030674

SMART Domains

Protein: ENSMUSP00000030674
Gene: ENSMUSG00000028860

Domain	Start	End	E-Value	Type
PDB:3BC1\|F	40	92	2e-9	PDB
low complexity region	169	183	N/A	INTRINSIC
low complexity region	235	262	N/A	INTRINSIC
C2	288	389	2.36e-17	SMART
C2	429	532	6.96e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000030677
AA Change: M1265V

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000030677
Gene: ENSMUSG00000028862
AA Change: M1265V

Domain	Start	End	E-Value	Type
low complexity region	98	109	N/A	INTRINSIC
Pfam:DUF4071	130	508	2.3e-150	PFAM
S_TKc	649	907	3.49e-87	SMART
low complexity region	925	940	N/A	INTRINSIC
low complexity region	947	960	N/A	INTRINSIC
low complexity region	975	990	N/A	INTRINSIC
low complexity region	1130	1146	N/A	INTRINSIC
coiled coil region	1164	1195	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105908

SMART Domains

Protein: ENSMUSP00000101528
Gene: ENSMUSG00000028860

Domain	Start	End	E-Value	Type
PDB:3BC1\|F	40	92	2e-9	PDB
low complexity region	157	171	N/A	INTRINSIC
low complexity region	223	250	N/A	INTRINSIC
C2	276	359	3.15e-4	SMART
C2	364	467	6.96e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123612

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127681

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134895

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142039

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154911

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.7%
20x: 90.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that forms a component of protein kinase-mediated signal transduction cascades. The encoded kinase participates in the regulation of vascular endothelial growth factor (VEGF) expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous and heterozygous null mice display an increased incidence of chemically induced skin tumors and homozygous mice also show resistance to induced apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak	A	T	19: 9,008,350	K2333*	probably null	Het
Aox4	C	T	1: 58,213,079	L38F	probably benign	Het
Arhgef15	T	C	11: 68,954,693	E111G	probably damaging	Het
Atp8a2	A	T	14: 59,860,212	I789N	probably damaging	Het
Cdca2	A	G	14: 67,700,347	S286P	possibly damaging	Het
Chrnb1	T	A	11: 69,784,757	K457M	probably damaging	Het
Clec2g	A	G	6: 128,980,261	I61V	possibly damaging	Het
Cyb5r3	G	A	15: 83,158,792	A233V	probably benign	Het
Cyp4a10	T	A	4: 115,525,377	L278*	probably null	Het
Dnmt1	T	C	9: 20,941,757	E56G	probably damaging	Het
Fam160b1	A	G	19: 57,368,578	T34A	possibly damaging	Het
Fam166a	T	A	2: 25,220,673	D164E	probably benign	Het
Fbln5	A	G	12: 101,809,714		probably null	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gabrr3	A	G	16: 59,440,596	D289G	probably damaging	Het
Gpr45	T	C	1: 43,033,016	L273P	probably damaging	Het
Hkdc1	T	C	10: 62,411,707	E125G	probably null	Het
Il25	A	G	14: 54,935,174		probably null	Het
Itfg1	A	T	8: 85,764,407	W298R	probably damaging	Het
Kank1	A	T	19: 25,410,603	K547*	probably null	Het
Lama5	G	A	2: 180,181,230	R2748*	probably null	Het
Lrp4	C	T	2: 91,477,734	T508I	probably damaging	Het
Map3k10	C	T	7: 27,663,360	V434I	probably damaging	Het
Mocs3	C	T	2: 168,231,682	P350S	probably benign	Het
Msh4	T	A	3: 153,888,825	Y113F	probably damaging	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Nrip1	A	G	16: 76,294,016	S218P	probably damaging	Het
Olfr1281	T	C	2: 111,328,787	Y123H	probably damaging	Het
Olfr1287	T	C	2: 111,449,788	I216T	probably benign	Het
Olig1	C	T	16: 91,270,652	S259F	probably damaging	Het
Osbpl9	A	G	4: 109,066,932	V499A	probably damaging	Het
Pafah2	T	C	4: 134,422,491	V371A	probably benign	Het
Pkp1	T	A	1: 135,875,683	M712L	probably benign	Het
Pkp1	T	C	1: 135,886,852	S244G	probably benign	Het
Ppp1r3a	T	C	6: 14,718,960	T652A	probably benign	Het
Rab21	A	T	10: 115,298,890	V108E	probably damaging	Het
Rab5b	C	T	10: 128,682,903	R120Q	probably benign	Het
Scd2	G	A	19: 44,301,246	V227I	probably benign	Het
Sema5b	T	A	16: 35,628,100	V82E	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Slc13a2	A	T	11: 78,404,800	L80*	probably null	Het
Slc1a5	C	T	7: 16,782,178	P93L	probably damaging	Het
Slc35b2	T	C	17: 45,566,463	V172A	probably benign	Het
Slfn8	A	G	11: 83,017,132	L195P	probably damaging	Het
Smox	G	A	2: 131,522,158	S320N	probably damaging	Het
Sptan1	T	C	2: 29,993,915	V589A	probably benign	Het
Stim2	G	A	5: 54,110,140		probably null	Het
V1ra8	A	G	6: 90,202,962	D49G	probably damaging	Het
Vmn1r233	A	T	17: 20,994,607	V27D	possibly damaging	Het
Vmn2r98	A	T	17: 19,065,827	K196*	probably null	Het
Wdr77	T	C	3: 105,962,066		probably null	Het

Other mutations in Map3k6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Map3k6	APN	4	133243044	splice site	probably benign
IGL01060:Map3k6	APN	4	133247302	splice site	probably null
IGL01116:Map3k6	APN	4	133247128	missense	probably damaging	0.98
IGL01341:Map3k6	APN	4	133248060	missense	possibly damaging	0.67
IGL02383:Map3k6	APN	4	133246621	splice site	probably null
IGL03090:Map3k6	APN	4	133243366	missense	probably benign	0.05
IGL03096:Map3k6	APN	4	133251345	nonsense	probably null
IGL03149:Map3k6	APN	4	133249688	missense	probably damaging	1.00
R0110:Map3k6	UTSW	4	133243794	missense	probably damaging	1.00
R0142:Map3k6	UTSW	4	133250946	missense	probably benign
R0189:Map3k6	UTSW	4	133246941	missense	possibly damaging	0.46
R0417:Map3k6	UTSW	4	133248082	nonsense	probably null
R0595:Map3k6	UTSW	4	133241263	missense	probably damaging	0.98
R0597:Map3k6	UTSW	4	133245552	missense	possibly damaging	0.46
R0699:Map3k6	UTSW	4	133248126	missense	probably damaging	1.00
R1099:Map3k6	UTSW	4	133247128	missense	probably damaging	1.00
R1113:Map3k6	UTSW	4	133245815	missense	probably damaging	1.00
R1308:Map3k6	UTSW	4	133245815	missense	probably damaging	1.00
R1607:Map3k6	UTSW	4	133252473	missense	probably damaging	1.00
R2217:Map3k6	UTSW	4	133246672	missense	possibly damaging	0.46
R3734:Map3k6	UTSW	4	133248396	missense	possibly damaging	0.79
R3735:Map3k6	UTSW	4	133246372	missense	probably benign	0.21
R3743:Map3k6	UTSW	4	133245073	missense	probably benign	0.26
R4244:Map3k6	UTSW	4	133251947	missense	possibly damaging	0.65
R4245:Map3k6	UTSW	4	133251947	missense	possibly damaging	0.65
R4465:Map3k6	UTSW	4	133246333	missense	possibly damaging	0.66
R4482:Map3k6	UTSW	4	133243399	missense	probably benign	0.00
R4827:Map3k6	UTSW	4	133248849	missense	possibly damaging	0.92
R5092:Map3k6	UTSW	4	133251743	missense	probably benign	0.00
R5110:Map3k6	UTSW	4	133247548	intron	probably benign
R5258:Map3k6	UTSW	4	133247642	missense	possibly damaging	0.81
R5369:Map3k6	UTSW	4	133247681	missense	probably damaging	0.99
R5642:Map3k6	UTSW	4	133245544	missense	probably damaging	0.99
R5648:Map3k6	UTSW	4	133243335	missense	probably benign	0.25
R6102:Map3k6	UTSW	4	133247131	critical splice donor site	probably null
R6144:Map3k6	UTSW	4	133245675	missense	probably damaging	1.00
R6476:Map3k6	UTSW	4	133250086	missense	probably damaging	0.98
R6511:Map3k6	UTSW	4	133248078	missense	probably damaging	0.98
R6522:Map3k6	UTSW	4	133250024	missense	possibly damaging	0.65
R6706:Map3k6	UTSW	4	133250939	nonsense	probably null
R6874:Map3k6	UTSW	4	133250656	missense	probably benign	0.02
R7069:Map3k6	UTSW	4	133251712	missense	probably benign	0.01
R7216:Map3k6	UTSW	4	133246900	missense	probably damaging	0.99
R7417:Map3k6	UTSW	4	133248396	missense	probably benign	0.43
R7538:Map3k6	UTSW	4	133251927	missense	probably benign
R7569:Map3k6	UTSW	4	133250077	missense	probably benign	0.04
R8003:Map3k6	UTSW	4	133248882	missense	probably benign	0.05
R8407:Map3k6	UTSW	4	133247593	missense	possibly damaging	0.95
R8817:Map3k6	UTSW	4	133246760	missense	probably benign	0.00
R8939:Map3k6	UTSW	4	133252643	unclassified	probably benign
R9285:Map3k6	UTSW	4	133245559	missense	probably damaging	1.00
R9308:Map3k6	UTSW	4	133243411	missense	probably damaging	1.00
R9400:Map3k6	UTSW	4	133241156	missense	probably damaging	1.00
R9401:Map3k6	UTSW	4	133241156	missense	probably damaging	1.00
R9573:Map3k6	UTSW	4	133252463	missense	probably damaging	0.99
R9677:Map3k6	UTSW	4	133241116	missense	probably benign	0.04
R9682:Map3k6	UTSW	4	133248108	missense	possibly damaging	0.61
R9745:Map3k6	UTSW	4	133252472	missense	probably damaging	1.00
R9751:Map3k6	UTSW	4	133251857	critical splice acceptor site	probably null
Z1088:Map3k6	UTSW	4	133245066	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCTCACCTGTGCCACTCAAGATG -3'
(R):5'- ACACCCTTCTGAAGTTGCCAAGAC -3'

Sequencing Primer
(F):5'- GGTATGTCTTGGGCCTTCC -3'
(R):5'- CAAGCATGGTAGCAAGTGTTCTG -3'

Posted On

2013-04-24