Incidental Mutation 'R0368:Pafah2'
ID30317
Institutional Source Beutler Lab
Gene Symbol Pafah2
Ensembl Gene ENSMUSG00000037366
Gene Nameplatelet-activating factor acetylhydrolase 2
Synonyms
MMRRC Submission 038574-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0368 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location134396320-134427413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134422491 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 371 (V371A)
Ref Sequence ENSEMBL: ENSMUSP00000101496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105869] [ENSMUST00000105870]
Predicted Effect probably benign
Transcript: ENSMUST00000105869
AA Change: V346A

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101495
Gene: ENSMUSG00000037366
AA Change: V346A

DomainStartEndE-ValueType
Pfam:PAF-AH_p_II 1 379 4.7e-157 PFAM
Pfam:Chlorophyllase2 92 263 4.4e-9 PFAM
Pfam:Abhydrolase_5 102 313 1.2e-16 PFAM
Pfam:Abhydrolase_6 103 276 7.2e-9 PFAM
Pfam:Peptidase_S9 200 265 1.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105870
AA Change: V371A

PolyPhen 2 Score 0.367 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101496
Gene: ENSMUSG00000037366
AA Change: V371A

DomainStartEndE-ValueType
Pfam:PAF-AH_p_II 26 404 8e-157 PFAM
Pfam:DLH 116 342 1.1e-6 PFAM
Pfam:Abhydrolase_5 127 338 4.8e-17 PFAM
Pfam:Peptidase_S9 226 291 5.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145626
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes platelet-activating factor acetylhydrolase isoform 2, a single-subunit intracellular enzyme that catalyzes the removal of the acetyl group at the SN-2 position of platelet-activating factor (identified as 1-O-alkyl-2-acetyl-sn-glyceryl-3-phosphorylcholine). However, this lipase exhibits a broader substrate specificity than simply platelet activating factor. Two other isoforms of intracellular platelet-activating factor acetylhydrolase exist, and both are multi-subunit enzymes. Additionally, there is a single-subunit serum isoform of this enzyme. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to hepatic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A T 19: 9,008,350 K2333* probably null Het
Aox4 C T 1: 58,213,079 L38F probably benign Het
Arhgef15 T C 11: 68,954,693 E111G probably damaging Het
Atp8a2 A T 14: 59,860,212 I789N probably damaging Het
Cdca2 A G 14: 67,700,347 S286P possibly damaging Het
Chrnb1 T A 11: 69,784,757 K457M probably damaging Het
Clec2g A G 6: 128,980,261 I61V possibly damaging Het
Cyb5r3 G A 15: 83,158,792 A233V probably benign Het
Cyp4a10 T A 4: 115,525,377 L278* probably null Het
Dnmt1 T C 9: 20,941,757 E56G probably damaging Het
Fam160b1 A G 19: 57,368,578 T34A possibly damaging Het
Fam166a T A 2: 25,220,673 D164E probably benign Het
Fbln5 A G 12: 101,809,714 probably null Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gabrr3 A G 16: 59,440,596 D289G probably damaging Het
Gpr45 T C 1: 43,033,016 L273P probably damaging Het
Hkdc1 T C 10: 62,411,707 E125G probably null Het
Il25 A G 14: 54,935,174 probably null Het
Itfg1 A T 8: 85,764,407 W298R probably damaging Het
Kank1 A T 19: 25,410,603 K547* probably null Het
Lama5 G A 2: 180,181,230 R2748* probably null Het
Lrp4 C T 2: 91,477,734 T508I probably damaging Het
Map3k10 C T 7: 27,663,360 V434I probably damaging Het
Map3k6 A G 4: 133,252,659 M1265V probably benign Het
Mocs3 C T 2: 168,231,682 P350S probably benign Het
Msh4 T A 3: 153,888,825 Y113F probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nrip1 A G 16: 76,294,016 S218P probably damaging Het
Olfr1281 T C 2: 111,328,787 Y123H probably damaging Het
Olfr1287 T C 2: 111,449,788 I216T probably benign Het
Olig1 C T 16: 91,270,652 S259F probably damaging Het
Osbpl9 A G 4: 109,066,932 V499A probably damaging Het
Pkp1 T A 1: 135,875,683 M712L probably benign Het
Pkp1 T C 1: 135,886,852 S244G probably benign Het
Ppp1r3a T C 6: 14,718,960 T652A probably benign Het
Rab21 A T 10: 115,298,890 V108E probably damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Scd2 G A 19: 44,301,246 V227I probably benign Het
Sema5b T A 16: 35,628,100 V82E probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Slc13a2 A T 11: 78,404,800 L80* probably null Het
Slc1a5 C T 7: 16,782,178 P93L probably damaging Het
Slc35b2 T C 17: 45,566,463 V172A probably benign Het
Slfn8 A G 11: 83,017,132 L195P probably damaging Het
Smox G A 2: 131,522,158 S320N probably damaging Het
Sptan1 T C 2: 29,993,915 V589A probably benign Het
Stim2 G A 5: 54,110,140 probably null Het
V1ra8 A G 6: 90,202,962 D49G probably damaging Het
Vmn1r233 A T 17: 20,994,607 V27D possibly damaging Het
Vmn2r98 A T 17: 19,065,827 K196* probably null Het
Wdr77 T C 3: 105,962,066 probably null Het
Other mutations in Pafah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03283:Pafah2 APN 4 134418097 missense probably damaging 1.00
R1456:Pafah2 UTSW 4 134404157 missense probably damaging 1.00
R1765:Pafah2 UTSW 4 134413447 missense probably benign 0.04
R1846:Pafah2 UTSW 4 134425541 frame shift probably null
R1847:Pafah2 UTSW 4 134425541 frame shift probably null
R1848:Pafah2 UTSW 4 134425541 frame shift probably null
R2984:Pafah2 UTSW 4 134411871 missense possibly damaging 0.94
R5921:Pafah2 UTSW 4 134418069 missense probably benign 0.17
R6088:Pafah2 UTSW 4 134413381 missense probably benign 0.02
R7289:Pafah2 UTSW 4 134419997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGCTGCCCTGGCAGAATTAC -3'
(R):5'- TGTGCTGATGTGCTGACCACTC -3'

Sequencing Primer
(F):5'- CTGGCAGAATTACCCTGACATATAG -3'
(R):5'- TGACCACTCTTTCAGCCAG -3'
Posted On2013-04-24