Incidental Mutation 'R0368:Stim2'
ID30320
Institutional Source Beutler Lab
Gene Symbol Stim2
Ensembl Gene ENSMUSG00000039156
Gene Namestromal interaction molecule 2
Synonyms
MMRRC Submission 038574-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0368 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location53998499-54121057 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 54110140 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117661] [ENSMUST00000201469]
Predicted Effect probably null
Transcript: ENSMUST00000071083
SMART Domains Protein: ENSMUSP00000069272
Gene: ENSMUSG00000039156

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
SAM 133 204 1.74e-3 SMART
PDB:4O9B|D 241 344 2e-36 PDB
Pfam:SOAR 345 453 1.7e-42 PFAM
low complexity region 513 526 N/A INTRINSIC
low complexity region 535 565 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 738 754 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117661
SMART Domains Protein: ENSMUSP00000113174
Gene: ENSMUSG00000039156

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
SAM 133 204 1.74e-3 SMART
PDB:4O9B|D 241 344 2e-36 PDB
PDB:3TEQ|D 348 448 2e-38 PDB
low complexity region 505 518 N/A INTRINSIC
low complexity region 527 557 N/A INTRINSIC
low complexity region 602 613 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201198
Predicted Effect probably null
Transcript: ENSMUST00000201469
SMART Domains Protein: ENSMUSP00000143855
Gene: ENSMUSG00000039156

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
SAM 133 204 1.74e-3 SMART
PDB:4O9B|D 241 344 2e-36 PDB
Pfam:SOAR 345 453 1.7e-42 PFAM
low complexity region 513 526 N/A INTRINSIC
low complexity region 535 565 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 738 754 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the stromal interaction molecule (STIM) family and likely arose, along with related family member STIM1, from a common ancestral gene. The encoded protein functions to regulate calcium concentrations in the cytosol and endoplasmic reticulum, and is involved in the activation of plasma membrane Orai Ca(2+) entry channels. This gene initiates translation from a non-AUG (UUG) start site. A signal peptide is cleaved from the resulting protein. Multiple transcript variants result from alternative splicing. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit a slight growth delay and premature death while embryonic fibroblasts show reduced store-operated Ca2+ influx. Mice homozygous for a different null allele show increased neuron survival under hypoxic conditions and resistance to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A T 19: 9,008,350 K2333* probably null Het
Aox4 C T 1: 58,213,079 L38F probably benign Het
Arhgef15 T C 11: 68,954,693 E111G probably damaging Het
Atp8a2 A T 14: 59,860,212 I789N probably damaging Het
Cdca2 A G 14: 67,700,347 S286P possibly damaging Het
Chrnb1 T A 11: 69,784,757 K457M probably damaging Het
Clec2g A G 6: 128,980,261 I61V possibly damaging Het
Cyb5r3 G A 15: 83,158,792 A233V probably benign Het
Cyp4a10 T A 4: 115,525,377 L278* probably null Het
Dnmt1 T C 9: 20,941,757 E56G probably damaging Het
Fam160b1 A G 19: 57,368,578 T34A possibly damaging Het
Fam166a T A 2: 25,220,673 D164E probably benign Het
Fbln5 A G 12: 101,809,714 probably null Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gabrr3 A G 16: 59,440,596 D289G probably damaging Het
Gpr45 T C 1: 43,033,016 L273P probably damaging Het
Hkdc1 T C 10: 62,411,707 E125G probably null Het
Il25 A G 14: 54,935,174 probably null Het
Itfg1 A T 8: 85,764,407 W298R probably damaging Het
Kank1 A T 19: 25,410,603 K547* probably null Het
Lama5 G A 2: 180,181,230 R2748* probably null Het
Lrp4 C T 2: 91,477,734 T508I probably damaging Het
Map3k10 C T 7: 27,663,360 V434I probably damaging Het
Map3k6 A G 4: 133,252,659 M1265V probably benign Het
Mocs3 C T 2: 168,231,682 P350S probably benign Het
Msh4 T A 3: 153,888,825 Y113F probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nrip1 A G 16: 76,294,016 S218P probably damaging Het
Olfr1281 T C 2: 111,328,787 Y123H probably damaging Het
Olfr1287 T C 2: 111,449,788 I216T probably benign Het
Olig1 C T 16: 91,270,652 S259F probably damaging Het
Osbpl9 A G 4: 109,066,932 V499A probably damaging Het
Pafah2 T C 4: 134,422,491 V371A probably benign Het
Pkp1 T A 1: 135,875,683 M712L probably benign Het
Pkp1 T C 1: 135,886,852 S244G probably benign Het
Ppp1r3a T C 6: 14,718,960 T652A probably benign Het
Rab21 A T 10: 115,298,890 V108E probably damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Scd2 G A 19: 44,301,246 V227I probably benign Het
Sema5b T A 16: 35,628,100 V82E probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Slc13a2 A T 11: 78,404,800 L80* probably null Het
Slc1a5 C T 7: 16,782,178 P93L probably damaging Het
Slc35b2 T C 17: 45,566,463 V172A probably benign Het
Slfn8 A G 11: 83,017,132 L195P probably damaging Het
Smox G A 2: 131,522,158 S320N probably damaging Het
Sptan1 T C 2: 29,993,915 V589A probably benign Het
V1ra8 A G 6: 90,202,962 D49G probably damaging Het
Vmn1r233 A T 17: 20,994,607 V27D possibly damaging Het
Vmn2r98 A T 17: 19,065,827 K196* probably null Het
Wdr77 T C 3: 105,962,066 probably null Het
Other mutations in Stim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Stim2 APN 5 54053493 missense probably benign 0.09
IGL02276:Stim2 APN 5 54053370 splice site probably benign
IGL02643:Stim2 APN 5 54110613 missense probably damaging 1.00
R0825:Stim2 UTSW 5 54118483 missense probably benign 0.22
R1453:Stim2 UTSW 5 54116109 missense probably damaging 1.00
R1549:Stim2 UTSW 5 54105325 missense probably damaging 1.00
R2103:Stim2 UTSW 5 54105249 missense possibly damaging 0.74
R2114:Stim2 UTSW 5 54104477 missense probably damaging 1.00
R2147:Stim2 UTSW 5 54105375 missense probably damaging 1.00
R2159:Stim2 UTSW 5 54109814 missense probably damaging 1.00
R4467:Stim2 UTSW 5 54116194 critical splice donor site probably null
R4809:Stim2 UTSW 5 54110613 missense probably damaging 1.00
R4857:Stim2 UTSW 5 54118546 missense probably damaging 1.00
R4959:Stim2 UTSW 5 54105370 missense probably benign
R5125:Stim2 UTSW 5 54110597 missense probably damaging 1.00
R5427:Stim2 UTSW 5 54110939 missense possibly damaging 0.95
R5441:Stim2 UTSW 5 54075370 nonsense probably null
R5617:Stim2 UTSW 5 54109733 missense probably damaging 0.99
R5924:Stim2 UTSW 5 54102643 missense probably benign 0.01
R6169:Stim2 UTSW 5 54118679 missense probably damaging 1.00
R6689:Stim2 UTSW 5 54115976 missense probably damaging 1.00
R6893:Stim2 UTSW 5 54053445 missense probably benign 0.13
R6971:Stim2 UTSW 5 54118299 nonsense probably null
R7133:Stim2 UTSW 5 53998921 missense possibly damaging 0.70
R7189:Stim2 UTSW 5 54116128 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TAGCCATCGCTAAGGACGAGGTAG -3'
(R):5'- AGATTTCTGTAGCCGCCCAAGACC -3'

Sequencing Primer
(F):5'- GACCTCAGTAAAAGCCCTTCTTG -3'
(R):5'- GCCCAAGACCAGAGTCTTC -3'
Posted On2013-04-24