Incidental Mutation 'R0368:Stim2'
ID 30320
Institutional Source Beutler Lab
Gene Symbol Stim2
Ensembl Gene ENSMUSG00000039156
Gene Name stromal interaction molecule 2
Synonyms
MMRRC Submission 038574-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0368 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 54155865-54278399 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 54267482 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117661] [ENSMUST00000201469]
AlphaFold P83093
Predicted Effect probably null
Transcript: ENSMUST00000071083
SMART Domains Protein: ENSMUSP00000069272
Gene: ENSMUSG00000039156

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
SAM 133 204 1.74e-3 SMART
PDB:4O9B|D 241 344 2e-36 PDB
Pfam:SOAR 345 453 1.7e-42 PFAM
low complexity region 513 526 N/A INTRINSIC
low complexity region 535 565 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 738 754 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117661
SMART Domains Protein: ENSMUSP00000113174
Gene: ENSMUSG00000039156

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
SAM 133 204 1.74e-3 SMART
PDB:4O9B|D 241 344 2e-36 PDB
PDB:3TEQ|D 348 448 2e-38 PDB
low complexity region 505 518 N/A INTRINSIC
low complexity region 527 557 N/A INTRINSIC
low complexity region 602 613 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201198
Predicted Effect probably null
Transcript: ENSMUST00000201469
SMART Domains Protein: ENSMUSP00000143855
Gene: ENSMUSG00000039156

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
SAM 133 204 1.74e-3 SMART
PDB:4O9B|D 241 344 2e-36 PDB
Pfam:SOAR 345 453 1.7e-42 PFAM
low complexity region 513 526 N/A INTRINSIC
low complexity region 535 565 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 738 754 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the stromal interaction molecule (STIM) family and likely arose, along with related family member STIM1, from a common ancestral gene. The encoded protein functions to regulate calcium concentrations in the cytosol and endoplasmic reticulum, and is involved in the activation of plasma membrane Orai Ca(2+) entry channels. This gene initiates translation from a non-AUG (UUG) start site. A signal peptide is cleaved from the resulting protein. Multiple transcript variants result from alternative splicing. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit a slight growth delay and premature death while embryonic fibroblasts show reduced store-operated Ca2+ influx. Mice homozygous for a different null allele show increased neuron survival under hypoxic conditions and resistance to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A T 19: 8,985,714 (GRCm39) K2333* probably null Het
Aox4 C T 1: 58,252,238 (GRCm39) L38F probably benign Het
Arhgef15 T C 11: 68,845,519 (GRCm39) E111G probably damaging Het
Atp8a2 A T 14: 60,097,661 (GRCm39) I789N probably damaging Het
Cdca2 A G 14: 67,937,796 (GRCm39) S286P possibly damaging Het
Chrnb1 T A 11: 69,675,583 (GRCm39) K457M probably damaging Het
Cimip2a T A 2: 25,110,685 (GRCm39) D164E probably benign Het
Clec2g A G 6: 128,957,224 (GRCm39) I61V possibly damaging Het
Cyb5r3 G A 15: 83,042,993 (GRCm39) A233V probably benign Het
Cyp4a10 T A 4: 115,382,574 (GRCm39) L278* probably null Het
Dnmt1 T C 9: 20,853,053 (GRCm39) E56G probably damaging Het
Fbln5 A G 12: 101,775,973 (GRCm39) probably null Het
Fhip2a A G 19: 57,357,010 (GRCm39) T34A possibly damaging Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gabrr3 A G 16: 59,260,959 (GRCm39) D289G probably damaging Het
Gpr45 T C 1: 43,072,176 (GRCm39) L273P probably damaging Het
Hkdc1 T C 10: 62,247,486 (GRCm39) E125G probably null Het
Il25 A G 14: 55,172,631 (GRCm39) probably null Het
Itfg1 A T 8: 86,491,036 (GRCm39) W298R probably damaging Het
Kank1 A T 19: 25,387,967 (GRCm39) K547* probably null Het
Lama5 G A 2: 179,823,023 (GRCm39) R2748* probably null Het
Lrp4 C T 2: 91,308,079 (GRCm39) T508I probably damaging Het
Map3k10 C T 7: 27,362,785 (GRCm39) V434I probably damaging Het
Map3k6 A G 4: 132,979,970 (GRCm39) M1265V probably benign Het
Mocs3 C T 2: 168,073,602 (GRCm39) P350S probably benign Het
Msh4 T A 3: 153,594,462 (GRCm39) Y113F probably damaging Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Nrip1 A G 16: 76,090,904 (GRCm39) S218P probably damaging Het
Olig1 C T 16: 91,067,540 (GRCm39) S259F probably damaging Het
Or4k37 T C 2: 111,159,132 (GRCm39) Y123H probably damaging Het
Or4k41 T C 2: 111,280,133 (GRCm39) I216T probably benign Het
Osbpl9 A G 4: 108,924,129 (GRCm39) V499A probably damaging Het
Pafah2 T C 4: 134,149,802 (GRCm39) V371A probably benign Het
Pkp1 T A 1: 135,803,421 (GRCm39) M712L probably benign Het
Pkp1 T C 1: 135,814,590 (GRCm39) S244G probably benign Het
Ppp1r3a T C 6: 14,718,959 (GRCm39) T652A probably benign Het
Rab21 A T 10: 115,134,795 (GRCm39) V108E probably damaging Het
Rab5b C T 10: 128,518,772 (GRCm39) R120Q probably benign Het
Scd2 G A 19: 44,289,685 (GRCm39) V227I probably benign Het
Sema5b T A 16: 35,448,470 (GRCm39) V82E probably damaging Het
Sema6a G A 18: 47,423,112 (GRCm39) probably null Het
Slc13a2 A T 11: 78,295,626 (GRCm39) L80* probably null Het
Slc1a5 C T 7: 16,516,103 (GRCm39) P93L probably damaging Het
Slc35b2 T C 17: 45,877,389 (GRCm39) V172A probably benign Het
Slfn8 A G 11: 82,907,958 (GRCm39) L195P probably damaging Het
Smox G A 2: 131,364,078 (GRCm39) S320N probably damaging Het
Sptan1 T C 2: 29,883,927 (GRCm39) V589A probably benign Het
V1ra8 A G 6: 90,179,944 (GRCm39) D49G probably damaging Het
Vmn1r233 A T 17: 21,214,869 (GRCm39) V27D possibly damaging Het
Vmn2r98 A T 17: 19,286,089 (GRCm39) K196* probably null Het
Wdr77 T C 3: 105,869,382 (GRCm39) probably null Het
Other mutations in Stim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Stim2 APN 5 54,210,835 (GRCm39) missense probably benign 0.09
IGL02276:Stim2 APN 5 54,210,712 (GRCm39) splice site probably benign
IGL02643:Stim2 APN 5 54,267,955 (GRCm39) missense probably damaging 1.00
R0825:Stim2 UTSW 5 54,275,825 (GRCm39) missense probably benign 0.22
R1453:Stim2 UTSW 5 54,273,451 (GRCm39) missense probably damaging 1.00
R1549:Stim2 UTSW 5 54,262,667 (GRCm39) missense probably damaging 1.00
R2103:Stim2 UTSW 5 54,262,591 (GRCm39) missense possibly damaging 0.74
R2114:Stim2 UTSW 5 54,261,819 (GRCm39) missense probably damaging 1.00
R2147:Stim2 UTSW 5 54,262,717 (GRCm39) missense probably damaging 1.00
R2159:Stim2 UTSW 5 54,267,156 (GRCm39) missense probably damaging 1.00
R4467:Stim2 UTSW 5 54,273,536 (GRCm39) critical splice donor site probably null
R4809:Stim2 UTSW 5 54,267,955 (GRCm39) missense probably damaging 1.00
R4857:Stim2 UTSW 5 54,275,888 (GRCm39) missense probably damaging 1.00
R4959:Stim2 UTSW 5 54,262,712 (GRCm39) missense probably benign
R5125:Stim2 UTSW 5 54,267,939 (GRCm39) missense probably damaging 1.00
R5427:Stim2 UTSW 5 54,268,281 (GRCm39) missense possibly damaging 0.95
R5441:Stim2 UTSW 5 54,232,712 (GRCm39) nonsense probably null
R5617:Stim2 UTSW 5 54,267,075 (GRCm39) missense probably damaging 0.99
R5924:Stim2 UTSW 5 54,259,985 (GRCm39) missense probably benign 0.01
R6169:Stim2 UTSW 5 54,276,021 (GRCm39) missense probably damaging 1.00
R6689:Stim2 UTSW 5 54,273,318 (GRCm39) missense probably damaging 1.00
R6893:Stim2 UTSW 5 54,210,787 (GRCm39) missense probably benign 0.13
R6971:Stim2 UTSW 5 54,275,641 (GRCm39) nonsense probably null
R7133:Stim2 UTSW 5 54,156,263 (GRCm39) missense possibly damaging 0.70
R7189:Stim2 UTSW 5 54,273,470 (GRCm39) missense probably benign 0.08
R7947:Stim2 UTSW 5 54,275,671 (GRCm39) missense probably damaging 0.99
R8806:Stim2 UTSW 5 54,156,257 (GRCm39) missense probably benign
R8939:Stim2 UTSW 5 54,262,673 (GRCm39) missense possibly damaging 0.55
R9567:Stim2 UTSW 5 54,232,707 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCCATCGCTAAGGACGAGGTAG -3'
(R):5'- AGATTTCTGTAGCCGCCCAAGACC -3'

Sequencing Primer
(F):5'- GACCTCAGTAAAAGCCCTTCTTG -3'
(R):5'- GCCCAAGACCAGAGTCTTC -3'
Posted On 2013-04-24