Mutagenetix > Incidental Mutation

Incidental Mutation 'R0368:Ppp1r3a'

30322

Institutional Source

Beutler Lab

Gene Symbol

Ppp1r3a

Ensembl Gene

ENSMUSG00000042717

Gene Name

protein phosphatase 1, regulatory (inhibitor) subunit 3A

Synonyms

RGL, GM

MMRRC Submission

038574-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0368 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

14713977-14755274 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 14718960 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 652 (T652A)

Ref Sequence

ENSEMBL: ENSMUSP00000049054 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045096]

AlphaFold

Q99MR9

Predicted Effect

probably benign
Transcript: ENSMUST00000045096
AA Change: T652A

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000049054
Gene: ENSMUSG00000042717
AA Change: T652A

Domain	Start	End	E-Value	Type
low complexity region	37	51	N/A	INTRINSIC
Pfam:CBM_21	124	231	2.3e-32	PFAM
low complexity region	370	381	N/A	INTRINSIC
low complexity region	636	646	N/A	INTRINSIC
low complexity region	952	961	N/A	INTRINSIC
transmembrane domain	1055	1077	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.7%
20x: 90.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycogen-associated form of protein phosphatase-1 (PP1) derived from skeletal muscle is a heterodimer composed of a 37-kD catalytic subunit and a 124-kD targeting and regulatory subunit. This gene encodes the regulatory subunit which binds to muscle glycogen with high affinity, thereby enhancing dephosphorylation of glycogen-bound substrates for PP1 such as glycogen synthase and glycogen phosphorylase kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have reduced levels of skeletal muscle glycogen. Whereas one model was normoglycemic and grossly normal, another on a similar genetic background was glucose intolerant, insulin resistant, and gained weight to the point of obesity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak	A	T	19: 9,008,350	K2333*	probably null	Het
Aox4	C	T	1: 58,213,079	L38F	probably benign	Het
Arhgef15	T	C	11: 68,954,693	E111G	probably damaging	Het
Atp8a2	A	T	14: 59,860,212	I789N	probably damaging	Het
Cdca2	A	G	14: 67,700,347	S286P	possibly damaging	Het
Chrnb1	T	A	11: 69,784,757	K457M	probably damaging	Het
Clec2g	A	G	6: 128,980,261	I61V	possibly damaging	Het
Cyb5r3	G	A	15: 83,158,792	A233V	probably benign	Het
Cyp4a10	T	A	4: 115,525,377	L278*	probably null	Het
Dnmt1	T	C	9: 20,941,757	E56G	probably damaging	Het
Fam160b1	A	G	19: 57,368,578	T34A	possibly damaging	Het
Fam166a	T	A	2: 25,220,673	D164E	probably benign	Het
Fbln5	A	G	12: 101,809,714		probably null	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gabrr3	A	G	16: 59,440,596	D289G	probably damaging	Het
Gpr45	T	C	1: 43,033,016	L273P	probably damaging	Het
Hkdc1	T	C	10: 62,411,707	E125G	probably null	Het
Il25	A	G	14: 54,935,174		probably null	Het
Itfg1	A	T	8: 85,764,407	W298R	probably damaging	Het
Kank1	A	T	19: 25,410,603	K547*	probably null	Het
Lama5	G	A	2: 180,181,230	R2748*	probably null	Het
Lrp4	C	T	2: 91,477,734	T508I	probably damaging	Het
Map3k10	C	T	7: 27,663,360	V434I	probably damaging	Het
Map3k6	A	G	4: 133,252,659	M1265V	probably benign	Het
Mocs3	C	T	2: 168,231,682	P350S	probably benign	Het
Msh4	T	A	3: 153,888,825	Y113F	probably damaging	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Nrip1	A	G	16: 76,294,016	S218P	probably damaging	Het
Olfr1281	T	C	2: 111,328,787	Y123H	probably damaging	Het
Olfr1287	T	C	2: 111,449,788	I216T	probably benign	Het
Olig1	C	T	16: 91,270,652	S259F	probably damaging	Het
Osbpl9	A	G	4: 109,066,932	V499A	probably damaging	Het
Pafah2	T	C	4: 134,422,491	V371A	probably benign	Het
Pkp1	T	A	1: 135,875,683	M712L	probably benign	Het
Pkp1	T	C	1: 135,886,852	S244G	probably benign	Het
Rab21	A	T	10: 115,298,890	V108E	probably damaging	Het
Rab5b	C	T	10: 128,682,903	R120Q	probably benign	Het
Scd2	G	A	19: 44,301,246	V227I	probably benign	Het
Sema5b	T	A	16: 35,628,100	V82E	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Slc13a2	A	T	11: 78,404,800	L80*	probably null	Het
Slc1a5	C	T	7: 16,782,178	P93L	probably damaging	Het
Slc35b2	T	C	17: 45,566,463	V172A	probably benign	Het
Slfn8	A	G	11: 83,017,132	L195P	probably damaging	Het
Smox	G	A	2: 131,522,158	S320N	probably damaging	Het
Sptan1	T	C	2: 29,993,915	V589A	probably benign	Het
Stim2	G	A	5: 54,110,140		probably null	Het
V1ra8	A	G	6: 90,202,962	D49G	probably damaging	Het
Vmn1r233	A	T	17: 20,994,607	V27D	possibly damaging	Het
Vmn2r98	A	T	17: 19,065,827	K196*	probably null	Het
Wdr77	T	C	3: 105,962,066		probably null	Het

Other mutations in Ppp1r3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Ppp1r3a	APN	6	14755084	missense	probably damaging	1.00
IGL00670:Ppp1r3a	APN	6	14719060	missense	probably benign	0.22
IGL00703:Ppp1r3a	APN	6	14718408	missense	probably benign	0.02
IGL00726:Ppp1r3a	APN	6	14717852	missense	probably benign	0.42
IGL00742:Ppp1r3a	APN	6	14718609	missense	probably benign	0.36
IGL01477:Ppp1r3a	APN	6	14718346	missense	probably damaging	0.99
IGL01632:Ppp1r3a	APN	6	14754811	missense	probably damaging	1.00
IGL02162:Ppp1r3a	APN	6	14717715	missense	probably damaging	1.00
IGL02374:Ppp1r3a	APN	6	14718600	missense	probably damaging	1.00
IGL02539:Ppp1r3a	APN	6	14718459	missense	probably benign	0.01
IGL02563:Ppp1r3a	APN	6	14719762	missense	probably benign	0.20
IGL02929:Ppp1r3a	APN	6	14719811	missense	probably benign	0.00
IGL03110:Ppp1r3a	APN	6	14722065	splice site	probably benign
IGL03290:Ppp1r3a	APN	6	14754772	missense	probably damaging	1.00
IGL03326:Ppp1r3a	APN	6	14719766	missense	probably damaging	0.96
P0041:Ppp1r3a	UTSW	6	14719697	missense	probably benign	0.00
PIT4445001:Ppp1r3a	UTSW	6	14717777	missense	probably damaging	1.00
R0015:Ppp1r3a	UTSW	6	14717661	missense	possibly damaging	0.58
R0077:Ppp1r3a	UTSW	6	14754517	missense	possibly damaging	0.64
R0391:Ppp1r3a	UTSW	6	14719697	missense	probably benign	0.43
R1793:Ppp1r3a	UTSW	6	14754718	missense	probably damaging	1.00
R1797:Ppp1r3a	UTSW	6	14717982	missense	probably benign	0.02
R1855:Ppp1r3a	UTSW	6	14754994	missense	probably damaging	1.00
R1864:Ppp1r3a	UTSW	6	14718405	missense	probably damaging	1.00
R1865:Ppp1r3a	UTSW	6	14718405	missense	probably damaging	1.00
R2046:Ppp1r3a	UTSW	6	14722104	missense	probably benign	0.12
R2122:Ppp1r3a	UTSW	6	14721875	missense	possibly damaging	0.95
R2437:Ppp1r3a	UTSW	6	14718323	missense	probably benign	0.03
R2518:Ppp1r3a	UTSW	6	14719378	missense	possibly damaging	0.95
R2887:Ppp1r3a	UTSW	6	14718249	missense	possibly damaging	0.89
R2888:Ppp1r3a	UTSW	6	14718249	missense	possibly damaging	0.89
R2889:Ppp1r3a	UTSW	6	14718249	missense	possibly damaging	0.89
R3419:Ppp1r3a	UTSW	6	14719414	missense	probably benign	0.01
R3886:Ppp1r3a	UTSW	6	14719912	missense	possibly damaging	0.87
R3937:Ppp1r3a	UTSW	6	14719074	missense	probably damaging	0.99
R3938:Ppp1r3a	UTSW	6	14719074	missense	probably damaging	0.99
R4246:Ppp1r3a	UTSW	6	14719781	missense	probably damaging	1.00
R4561:Ppp1r3a	UTSW	6	14754682	missense	probably damaging	1.00
R4701:Ppp1r3a	UTSW	6	14718993	missense	probably benign	0.00
R4853:Ppp1r3a	UTSW	6	14719047	missense	probably benign	0.03
R5076:Ppp1r3a	UTSW	6	14754681	missense	probably damaging	1.00
R5085:Ppp1r3a	UTSW	6	14719604	missense	probably damaging	1.00
R5501:Ppp1r3a	UTSW	6	14719418	missense	probably benign	0.02
R5725:Ppp1r3a	UTSW	6	14719349	missense	probably benign	0.04
R5729:Ppp1r3a	UTSW	6	14719763	missense	probably benign	0.06
R5741:Ppp1r3a	UTSW	6	14719883	missense	probably damaging	0.97
R5841:Ppp1r3a	UTSW	6	14718984	missense	probably benign	0.26
R5914:Ppp1r3a	UTSW	6	14718989	missense	probably benign	0.09
R6091:Ppp1r3a	UTSW	6	14719340	missense	probably benign	0.02
R6154:Ppp1r3a	UTSW	6	14754604	missense	possibly damaging	0.88
R6218:Ppp1r3a	UTSW	6	14718431	missense	probably damaging	0.99
R6813:Ppp1r3a	UTSW	6	14719571	missense	probably benign	0.13
R6826:Ppp1r3a	UTSW	6	14718981	nonsense	probably null
R6869:Ppp1r3a	UTSW	6	14754826	missense	probably benign	0.39
R7109:Ppp1r3a	UTSW	6	14719236	missense	probably benign	0.00
R7188:Ppp1r3a	UTSW	6	14719191	missense	probably benign	0.00
R7262:Ppp1r3a	UTSW	6	14719070	missense	probably benign	0.04
R7341:Ppp1r3a	UTSW	6	14718750	missense	probably damaging	0.97
R7770:Ppp1r3a	UTSW	6	14754978	missense	probably benign	0.06
R7856:Ppp1r3a	UTSW	6	14718026	missense	probably benign	0.01
R8309:Ppp1r3a	UTSW	6	14719701	missense	probably benign	0.02
R8422:Ppp1r3a	UTSW	6	14718435	nonsense	probably null
R8868:Ppp1r3a	UTSW	6	14755015	missense	probably damaging	1.00
R9039:Ppp1r3a	UTSW	6	14754526	missense	probably damaging	1.00
R9149:Ppp1r3a	UTSW	6	14722099	missense	probably benign	0.32
R9302:Ppp1r3a	UTSW	6	14721892	missense	probably benign	0.00
R9399:Ppp1r3a	UTSW	6	14755011	missense	probably damaging	0.99
R9565:Ppp1r3a	UTSW	6	14719467	missense	probably benign	0.02
R9730:Ppp1r3a	UTSW	6	14721924	missense	probably benign	0.25
R9767:Ppp1r3a	UTSW	6	14718102	missense	probably benign	0.03
R9782:Ppp1r3a	UTSW	6	14718767	missense	probably damaging	1.00
Z1177:Ppp1r3a	UTSW	6	14755151	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- AGCTGTAACTGCTTGTGCTTTCTCAG -3'
(R):5'- TCAGTATTCCAGACCCAAGAGGGAC -3'

Sequencing Primer
(F):5'- GCTTTCTCAGTAATACCATGATCAGC -3'
(R):5'- TATTACAGCTAACACCTGGGCG -3'

Posted On

2013-04-24