Incidental Mutation 'R0368:Itfg1'
ID30325
Institutional Source Beutler Lab
Gene Symbol Itfg1
Ensembl Gene ENSMUSG00000031703
Gene Nameintegrin alpha FG-GAP repeat containing 1
SynonymsD8Wsu49e, 2310047C21Rik
MMRRC Submission 038574-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R0368 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location85717578-85840921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85764407 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 298 (W298R)
Ref Sequence ENSEMBL: ENSMUSP00000034140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034140]
Predicted Effect probably damaging
Transcript: ENSMUST00000034140
AA Change: W298R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034140
Gene: ENSMUSG00000031703
AA Change: W298R

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
SCOP:d1m1xa4 46 232 5e-3 SMART
low complexity region 482 496 N/A INTRINSIC
transmembrane domain 564 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210912
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A T 19: 9,008,350 K2333* probably null Het
Aox4 C T 1: 58,213,079 L38F probably benign Het
Arhgef15 T C 11: 68,954,693 E111G probably damaging Het
Atp8a2 A T 14: 59,860,212 I789N probably damaging Het
Cdca2 A G 14: 67,700,347 S286P possibly damaging Het
Chrnb1 T A 11: 69,784,757 K457M probably damaging Het
Clec2g A G 6: 128,980,261 I61V possibly damaging Het
Cyb5r3 G A 15: 83,158,792 A233V probably benign Het
Cyp4a10 T A 4: 115,525,377 L278* probably null Het
Dnmt1 T C 9: 20,941,757 E56G probably damaging Het
Fam160b1 A G 19: 57,368,578 T34A possibly damaging Het
Fam166a T A 2: 25,220,673 D164E probably benign Het
Fbln5 A G 12: 101,809,714 probably null Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gabrr3 A G 16: 59,440,596 D289G probably damaging Het
Gpr45 T C 1: 43,033,016 L273P probably damaging Het
Hkdc1 T C 10: 62,411,707 E125G probably null Het
Il25 A G 14: 54,935,174 probably null Het
Kank1 A T 19: 25,410,603 K547* probably null Het
Lama5 G A 2: 180,181,230 R2748* probably null Het
Lrp4 C T 2: 91,477,734 T508I probably damaging Het
Map3k10 C T 7: 27,663,360 V434I probably damaging Het
Map3k6 A G 4: 133,252,659 M1265V probably benign Het
Mocs3 C T 2: 168,231,682 P350S probably benign Het
Msh4 T A 3: 153,888,825 Y113F probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nrip1 A G 16: 76,294,016 S218P probably damaging Het
Olfr1281 T C 2: 111,328,787 Y123H probably damaging Het
Olfr1287 T C 2: 111,449,788 I216T probably benign Het
Olig1 C T 16: 91,270,652 S259F probably damaging Het
Osbpl9 A G 4: 109,066,932 V499A probably damaging Het
Pafah2 T C 4: 134,422,491 V371A probably benign Het
Pkp1 T A 1: 135,875,683 M712L probably benign Het
Pkp1 T C 1: 135,886,852 S244G probably benign Het
Ppp1r3a T C 6: 14,718,960 T652A probably benign Het
Rab21 A T 10: 115,298,890 V108E probably damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Scd2 G A 19: 44,301,246 V227I probably benign Het
Sema5b T A 16: 35,628,100 V82E probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Slc13a2 A T 11: 78,404,800 L80* probably null Het
Slc1a5 C T 7: 16,782,178 P93L probably damaging Het
Slc35b2 T C 17: 45,566,463 V172A probably benign Het
Slfn8 A G 11: 83,017,132 L195P probably damaging Het
Smox G A 2: 131,522,158 S320N probably damaging Het
Sptan1 T C 2: 29,993,915 V589A probably benign Het
Stim2 G A 5: 54,110,140 probably null Het
V1ra8 A G 6: 90,202,962 D49G probably damaging Het
Vmn1r233 A T 17: 20,994,607 V27D possibly damaging Het
Vmn2r98 A T 17: 19,065,827 K196* probably null Het
Wdr77 T C 3: 105,962,066 probably null Het
Other mutations in Itfg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02579:Itfg1 APN 8 85780565 missense possibly damaging 0.95
IGL02803:Itfg1 APN 8 85725511 splice site probably null
R0755:Itfg1 UTSW 8 85726205 missense possibly damaging 0.90
R1183:Itfg1 UTSW 8 85780523 missense probably benign 0.04
R1529:Itfg1 UTSW 8 85810614 missense probably benign 0.02
R1789:Itfg1 UTSW 8 85725512 critical splice donor site probably null
R1953:Itfg1 UTSW 8 85831231 missense probably benign 0.31
R2206:Itfg1 UTSW 8 85776198 missense probably benign 0.17
R2207:Itfg1 UTSW 8 85776198 missense probably benign 0.17
R2260:Itfg1 UTSW 8 85722677 missense probably damaging 1.00
R2358:Itfg1 UTSW 8 85738129 missense probably damaging 1.00
R2876:Itfg1 UTSW 8 85780510 splice site probably benign
R2990:Itfg1 UTSW 8 85835049 missense possibly damaging 0.82
R4484:Itfg1 UTSW 8 85726249 missense probably damaging 1.00
R4762:Itfg1 UTSW 8 85732441 missense possibly damaging 0.95
R5146:Itfg1 UTSW 8 85718868 makesense probably null
R5796:Itfg1 UTSW 8 85718893 missense probably damaging 1.00
R5805:Itfg1 UTSW 8 85766972 missense probably benign 0.04
R6084:Itfg1 UTSW 8 85726170 missense probably benign 0.01
R6187:Itfg1 UTSW 8 85836465 missense probably damaging 1.00
R6319:Itfg1 UTSW 8 85840629 missense probably damaging 1.00
R6463:Itfg1 UTSW 8 85736151 missense probably benign 0.03
R6490:Itfg1 UTSW 8 85740301 missense probably benign 0.08
R6492:Itfg1 UTSW 8 85740349 missense probably benign 0.14
R6588:Itfg1 UTSW 8 85736130 missense probably benign
R6753:Itfg1 UTSW 8 85835078 missense probably benign 0.04
R7489:Itfg1 UTSW 8 85767001 missense probably damaging 1.00
R7665:Itfg1 UTSW 8 85764350 missense probably benign
R7912:Itfg1 UTSW 8 85764280 missense probably damaging 1.00
R7985:Itfg1 UTSW 8 85725568 missense probably damaging 1.00
X0067:Itfg1 UTSW 8 85840753 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGTGTCTGCCATGCAGTTTACCC -3'
(R):5'- GTGTGCTGTTCAAGCAAAGATGCTC -3'

Sequencing Primer
(F):5'- ACCCCCTACCTTCCAGATG -3'
(R):5'- GTCTTCAGCACTTTGGATGGATC -3'
Posted On2013-04-24