Incidental Mutation 'R0368:Hkdc1'
ID 30327
Institutional Source Beutler Lab
Gene Symbol Hkdc1
Ensembl Gene ENSMUSG00000020080
Gene Name hexokinase domain containing 1
Synonyms
MMRRC Submission 038574-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # R0368 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 62218916-62258270 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 62247486 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 125 (E125G)
Ref Sequence ENSEMBL: ENSMUSP00000020277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020277] [ENSMUST00000020277]
AlphaFold Q91W97
Predicted Effect probably null
Transcript: ENSMUST00000020277
AA Change: E125G

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000020277
Gene: ENSMUSG00000020080
AA Change: E125G

DomainStartEndE-ValueType
Pfam:Hexokinase_1 21 220 3.3e-71 PFAM
Pfam:Hexokinase_2 225 459 5.6e-79 PFAM
Pfam:Hexokinase_1 469 665 9.5e-76 PFAM
Pfam:Hexokinase_2 670 904 5.1e-84 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000020277
AA Change: E125G

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000020277
Gene: ENSMUSG00000020080
AA Change: E125G

DomainStartEndE-ValueType
Pfam:Hexokinase_1 21 220 3.3e-71 PFAM
Pfam:Hexokinase_2 225 459 5.6e-79 PFAM
Pfam:Hexokinase_1 469 665 9.5e-76 PFAM
Pfam:Hexokinase_2 670 904 5.1e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159579
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hexokinase protein family. The encoded protein is involved in glucose metabolism, and reduced expression may be associated with gestational diabetes mellitus. High expression of this gene may also be associated with poor prognosis in hepatocarcinoma. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality prior to genotyping. Mice heterozygous for a knock-out allele exhibit impaired glucose tolerance and female-specific increased in hepatic triglyceride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A T 19: 8,985,714 (GRCm39) K2333* probably null Het
Aox4 C T 1: 58,252,238 (GRCm39) L38F probably benign Het
Arhgef15 T C 11: 68,845,519 (GRCm39) E111G probably damaging Het
Atp8a2 A T 14: 60,097,661 (GRCm39) I789N probably damaging Het
Cdca2 A G 14: 67,937,796 (GRCm39) S286P possibly damaging Het
Chrnb1 T A 11: 69,675,583 (GRCm39) K457M probably damaging Het
Cimip2a T A 2: 25,110,685 (GRCm39) D164E probably benign Het
Clec2g A G 6: 128,957,224 (GRCm39) I61V possibly damaging Het
Cyb5r3 G A 15: 83,042,993 (GRCm39) A233V probably benign Het
Cyp4a10 T A 4: 115,382,574 (GRCm39) L278* probably null Het
Dnmt1 T C 9: 20,853,053 (GRCm39) E56G probably damaging Het
Fbln5 A G 12: 101,775,973 (GRCm39) probably null Het
Fhip2a A G 19: 57,357,010 (GRCm39) T34A possibly damaging Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gabrr3 A G 16: 59,260,959 (GRCm39) D289G probably damaging Het
Gpr45 T C 1: 43,072,176 (GRCm39) L273P probably damaging Het
Il25 A G 14: 55,172,631 (GRCm39) probably null Het
Itfg1 A T 8: 86,491,036 (GRCm39) W298R probably damaging Het
Kank1 A T 19: 25,387,967 (GRCm39) K547* probably null Het
Lama5 G A 2: 179,823,023 (GRCm39) R2748* probably null Het
Lrp4 C T 2: 91,308,079 (GRCm39) T508I probably damaging Het
Map3k10 C T 7: 27,362,785 (GRCm39) V434I probably damaging Het
Map3k6 A G 4: 132,979,970 (GRCm39) M1265V probably benign Het
Mocs3 C T 2: 168,073,602 (GRCm39) P350S probably benign Het
Msh4 T A 3: 153,594,462 (GRCm39) Y113F probably damaging Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Nrip1 A G 16: 76,090,904 (GRCm39) S218P probably damaging Het
Olig1 C T 16: 91,067,540 (GRCm39) S259F probably damaging Het
Or4k37 T C 2: 111,159,132 (GRCm39) Y123H probably damaging Het
Or4k41 T C 2: 111,280,133 (GRCm39) I216T probably benign Het
Osbpl9 A G 4: 108,924,129 (GRCm39) V499A probably damaging Het
Pafah2 T C 4: 134,149,802 (GRCm39) V371A probably benign Het
Pkp1 T A 1: 135,803,421 (GRCm39) M712L probably benign Het
Pkp1 T C 1: 135,814,590 (GRCm39) S244G probably benign Het
Ppp1r3a T C 6: 14,718,959 (GRCm39) T652A probably benign Het
Rab21 A T 10: 115,134,795 (GRCm39) V108E probably damaging Het
Rab5b C T 10: 128,518,772 (GRCm39) R120Q probably benign Het
Scd2 G A 19: 44,289,685 (GRCm39) V227I probably benign Het
Sema5b T A 16: 35,448,470 (GRCm39) V82E probably damaging Het
Sema6a G A 18: 47,423,112 (GRCm39) probably null Het
Slc13a2 A T 11: 78,295,626 (GRCm39) L80* probably null Het
Slc1a5 C T 7: 16,516,103 (GRCm39) P93L probably damaging Het
Slc35b2 T C 17: 45,877,389 (GRCm39) V172A probably benign Het
Slfn8 A G 11: 82,907,958 (GRCm39) L195P probably damaging Het
Smox G A 2: 131,364,078 (GRCm39) S320N probably damaging Het
Sptan1 T C 2: 29,883,927 (GRCm39) V589A probably benign Het
Stim2 G A 5: 54,267,482 (GRCm39) probably null Het
V1ra8 A G 6: 90,179,944 (GRCm39) D49G probably damaging Het
Vmn1r233 A T 17: 21,214,869 (GRCm39) V27D possibly damaging Het
Vmn2r98 A T 17: 19,286,089 (GRCm39) K196* probably null Het
Wdr77 T C 3: 105,869,382 (GRCm39) probably null Het
Other mutations in Hkdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Hkdc1 APN 10 62,229,568 (GRCm39) missense probably damaging 0.99
IGL01300:Hkdc1 APN 10 62,231,040 (GRCm39) splice site probably benign
IGL01415:Hkdc1 APN 10 62,229,638 (GRCm39) missense probably damaging 1.00
IGL01935:Hkdc1 APN 10 62,236,165 (GRCm39) missense probably damaging 0.97
IGL02903:Hkdc1 APN 10 62,235,970 (GRCm39) critical splice donor site probably null
IGL03100:Hkdc1 APN 10 62,253,608 (GRCm39) missense probably benign 0.00
IGL03154:Hkdc1 APN 10 62,221,484 (GRCm39) missense probably damaging 1.00
R0549:Hkdc1 UTSW 10 62,236,019 (GRCm39) missense probably benign
R0667:Hkdc1 UTSW 10 62,247,644 (GRCm39) splice site probably benign
R0751:Hkdc1 UTSW 10 62,234,452 (GRCm39) missense probably damaging 0.99
R1779:Hkdc1 UTSW 10 62,227,162 (GRCm39) missense probably damaging 1.00
R1929:Hkdc1 UTSW 10 62,253,677 (GRCm39) missense probably benign 0.01
R2271:Hkdc1 UTSW 10 62,253,677 (GRCm39) missense probably benign 0.01
R3831:Hkdc1 UTSW 10 62,235,991 (GRCm39) missense probably benign
R4480:Hkdc1 UTSW 10 62,227,151 (GRCm39) missense probably benign
R4561:Hkdc1 UTSW 10 62,245,618 (GRCm39) missense probably benign 0.00
R4576:Hkdc1 UTSW 10 62,221,622 (GRCm39) missense possibly damaging 0.56
R4655:Hkdc1 UTSW 10 62,236,242 (GRCm39) missense probably benign 0.09
R4723:Hkdc1 UTSW 10 62,236,133 (GRCm39) missense probably benign 0.00
R4810:Hkdc1 UTSW 10 62,247,304 (GRCm39) missense probably benign 0.08
R5086:Hkdc1 UTSW 10 62,231,053 (GRCm39) intron probably benign
R5138:Hkdc1 UTSW 10 62,234,470 (GRCm39) missense probably damaging 1.00
R5781:Hkdc1 UTSW 10 62,253,712 (GRCm39) missense probably damaging 0.98
R5900:Hkdc1 UTSW 10 62,244,445 (GRCm39) missense possibly damaging 0.91
R5982:Hkdc1 UTSW 10 62,229,589 (GRCm39) missense probably benign
R6418:Hkdc1 UTSW 10 62,219,583 (GRCm39) missense possibly damaging 0.93
R6463:Hkdc1 UTSW 10 62,229,481 (GRCm39) missense probably damaging 1.00
R6612:Hkdc1 UTSW 10 62,231,220 (GRCm39) missense possibly damaging 0.48
R6673:Hkdc1 UTSW 10 62,239,385 (GRCm39) missense probably damaging 0.99
R6761:Hkdc1 UTSW 10 62,244,477 (GRCm39) missense possibly damaging 0.93
R6915:Hkdc1 UTSW 10 62,237,711 (GRCm39) missense possibly damaging 0.92
R7114:Hkdc1 UTSW 10 62,229,622 (GRCm39) missense probably damaging 1.00
R7395:Hkdc1 UTSW 10 62,221,478 (GRCm39) missense probably damaging 1.00
R8498:Hkdc1 UTSW 10 62,221,662 (GRCm39) missense probably benign
R8777:Hkdc1 UTSW 10 62,234,612 (GRCm39) missense possibly damaging 0.94
R8777-TAIL:Hkdc1 UTSW 10 62,234,612 (GRCm39) missense possibly damaging 0.94
R8894:Hkdc1 UTSW 10 62,244,400 (GRCm39) missense probably damaging 1.00
R8989:Hkdc1 UTSW 10 62,229,544 (GRCm39) missense probably damaging 1.00
R9331:Hkdc1 UTSW 10 62,236,114 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGAGGCAGCTTCTTATGTGTCAG -3'
(R):5'- ATATCCCCAACCCTCAGGCTAGTG -3'

Sequencing Primer
(F):5'- CAGCTTCTTATGTGTCAGATTTTTG -3'
(R):5'- TGGTGACACTAATCCGCAG -3'
Posted On 2013-04-24