Mutagenetix > Incidental Mutation

Incidental Mutation 'R0368:Slfn8'

30333

Institutional Source

Beutler Lab

Gene Symbol

Slfn8

Ensembl Gene

ENSMUSG00000035208

Gene Name

schlafen 8

Synonyms

MMRRC Submission

038574-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.062) question?

Stock #

R0368 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83002158-83020810 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 83017132 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 195 (L195P)

Ref Sequence

ENSEMBL: ENSMUSP00000149800 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038141] [ENSMUST00000092838] [ENSMUST00000108152] [ENSMUST00000130822] [ENSMUST00000215239]

AlphaFold

B1ARD8

Predicted Effect

probably damaging
Transcript: ENSMUST00000038141
AA Change: L195P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000040060
Gene: ENSMUSG00000035208
AA Change: L195P

Domain	Start	End	E-Value	Type
Pfam:AAA_4	205	343	1.6e-18	PFAM
Pfam:DUF2075	592	766	5.8e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000092838
AA Change: L195P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000090513
Gene: ENSMUSG00000035208
AA Change: L195P

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	205	341	1.4e-17	PFAM
Pfam:DUF2075	592	767	2.2e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108152
AA Change: L195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103787
Gene: ENSMUSG00000035208
AA Change: L195P

Domain	Start	End	E-Value	Type
Pfam:AAA_4	205	343	4.1e-19	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000130822
AA Change: L195P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000114417
Gene: ENSMUSG00000035208
AA Change: L195P

Domain	Start	End	E-Value	Type
Pfam:AAA_4	205	343	3.7e-19	PFAM
SCOP:d1ly1a_	593	625	4e-3	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000131883
AA Change: L16P

SMART Domains

Protein: ENSMUSP00000121831
Gene: ENSMUSG00000035208
AA Change: L16P

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	27	163	1.8e-15	PFAM
SCOP:d1ly1a_	370	402	2e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000215239
AA Change: L195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.7%
20x: 90.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak	A	T	19: 9,008,350	K2333*	probably null	Het
Aox4	C	T	1: 58,213,079	L38F	probably benign	Het
Arhgef15	T	C	11: 68,954,693	E111G	probably damaging	Het
Atp8a2	A	T	14: 59,860,212	I789N	probably damaging	Het
Cdca2	A	G	14: 67,700,347	S286P	possibly damaging	Het
Chrnb1	T	A	11: 69,784,757	K457M	probably damaging	Het
Clec2g	A	G	6: 128,980,261	I61V	possibly damaging	Het
Cyb5r3	G	A	15: 83,158,792	A233V	probably benign	Het
Cyp4a10	T	A	4: 115,525,377	L278*	probably null	Het
Dnmt1	T	C	9: 20,941,757	E56G	probably damaging	Het
Fam160b1	A	G	19: 57,368,578	T34A	possibly damaging	Het
Fam166a	T	A	2: 25,220,673	D164E	probably benign	Het
Fbln5	A	G	12: 101,809,714		probably null	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gabrr3	A	G	16: 59,440,596	D289G	probably damaging	Het
Gpr45	T	C	1: 43,033,016	L273P	probably damaging	Het
Hkdc1	T	C	10: 62,411,707	E125G	probably null	Het
Il25	A	G	14: 54,935,174		probably null	Het
Itfg1	A	T	8: 85,764,407	W298R	probably damaging	Het
Kank1	A	T	19: 25,410,603	K547*	probably null	Het
Lama5	G	A	2: 180,181,230	R2748*	probably null	Het
Lrp4	C	T	2: 91,477,734	T508I	probably damaging	Het
Map3k10	C	T	7: 27,663,360	V434I	probably damaging	Het
Map3k6	A	G	4: 133,252,659	M1265V	probably benign	Het
Mocs3	C	T	2: 168,231,682	P350S	probably benign	Het
Msh4	T	A	3: 153,888,825	Y113F	probably damaging	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Nrip1	A	G	16: 76,294,016	S218P	probably damaging	Het
Olfr1281	T	C	2: 111,328,787	Y123H	probably damaging	Het
Olfr1287	T	C	2: 111,449,788	I216T	probably benign	Het
Olig1	C	T	16: 91,270,652	S259F	probably damaging	Het
Osbpl9	A	G	4: 109,066,932	V499A	probably damaging	Het
Pafah2	T	C	4: 134,422,491	V371A	probably benign	Het
Pkp1	T	A	1: 135,875,683	M712L	probably benign	Het
Pkp1	T	C	1: 135,886,852	S244G	probably benign	Het
Ppp1r3a	T	C	6: 14,718,960	T652A	probably benign	Het
Rab21	A	T	10: 115,298,890	V108E	probably damaging	Het
Rab5b	C	T	10: 128,682,903	R120Q	probably benign	Het
Scd2	G	A	19: 44,301,246	V227I	probably benign	Het
Sema5b	T	A	16: 35,628,100	V82E	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Slc13a2	A	T	11: 78,404,800	L80*	probably null	Het
Slc1a5	C	T	7: 16,782,178	P93L	probably damaging	Het
Slc35b2	T	C	17: 45,566,463	V172A	probably benign	Het
Smox	G	A	2: 131,522,158	S320N	probably damaging	Het
Sptan1	T	C	2: 29,993,915	V589A	probably benign	Het
Stim2	G	A	5: 54,110,140		probably null	Het
V1ra8	A	G	6: 90,202,962	D49G	probably damaging	Het
Vmn1r233	A	T	17: 20,994,607	V27D	possibly damaging	Het
Vmn2r98	A	T	17: 19,065,827	K196*	probably null	Het
Wdr77	T	C	3: 105,962,066		probably null	Het

Other mutations in Slfn8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00500:Slfn8	APN	11	83013484	missense	possibly damaging	0.75
IGL01418:Slfn8	APN	11	83004636	missense	probably damaging	1.00
IGL01620:Slfn8	APN	11	83004233	nonsense	probably null
IGL01875:Slfn8	APN	11	83004079	missense	probably benign	0.30
IGL01896:Slfn8	APN	11	83003696	missense	probably damaging	1.00
IGL01929:Slfn8	APN	11	83003405	nonsense	probably null
IGL02111:Slfn8	APN	11	83004498	missense	probably damaging	1.00
IGL02136:Slfn8	APN	11	83003465	nonsense	probably null
IGL02165:Slfn8	APN	11	83017196	missense	probably benign	0.00
IGL02645:Slfn8	APN	11	83003554	missense	possibly damaging	0.82
IGL02682:Slfn8	APN	11	83003691	missense	probably damaging	1.00
IGL02689:Slfn8	APN	11	83017108	missense	probably damaging	1.00
IGL02948:Slfn8	APN	11	83003252	missense	probably damaging	0.99
IGL03037:Slfn8	APN	11	83003252	missense	probably damaging	0.99
IGL03185:Slfn8	APN	11	83017507	missense	probably benign	0.01
IGL03243:Slfn8	APN	11	83003707	missense	probably damaging	1.00
IGL03286:Slfn8	APN	11	83013468	missense	probably damaging	0.99
seven_dwarfs	UTSW	11	83003334	missense	probably benign	0.09
vanwinkle	UTSW	11	83017393	missense	probably damaging	1.00
R0295:Slfn8	UTSW	11	83003343	nonsense	probably null
R0382:Slfn8	UTSW	11	83004556	missense	probably damaging	1.00
R0655:Slfn8	UTSW	11	83003821	missense	probably benign	0.35
R0894:Slfn8	UTSW	11	83003581	missense	probably benign	0.07
R1006:Slfn8	UTSW	11	83003511	missense	possibly damaging	0.69
R1181:Slfn8	UTSW	11	83016745	missense	probably benign	0.19
R1187:Slfn8	UTSW	11	83003488	missense	probably damaging	1.00
R1501:Slfn8	UTSW	11	83003180	missense	probably damaging	0.99
R1646:Slfn8	UTSW	11	83016886	missense	probably damaging	1.00
R1909:Slfn8	UTSW	11	83003621	nonsense	probably null
R2005:Slfn8	UTSW	11	83004150	missense	probably damaging	1.00
R2363:Slfn8	UTSW	11	83004094	missense	probably damaging	1.00
R3780:Slfn8	UTSW	11	83017454	missense	probably benign	0.13
R3890:Slfn8	UTSW	11	83004444	missense	possibly damaging	0.68
R3917:Slfn8	UTSW	11	83016993	nonsense	probably null
R4559:Slfn8	UTSW	11	83004744	missense	probably damaging	1.00
R4684:Slfn8	UTSW	11	83017506	missense	probably benign	0.10
R4767:Slfn8	UTSW	11	83003197	missense	possibly damaging	0.66
R4773:Slfn8	UTSW	11	83017393	missense	probably damaging	1.00
R4859:Slfn8	UTSW	11	83017714	start codon destroyed	probably null	0.99
R4916:Slfn8	UTSW	11	83016878	missense	probably damaging	1.00
R4939:Slfn8	UTSW	11	83003285	missense	probably benign	0.01
R5107:Slfn8	UTSW	11	83017150	missense	probably damaging	0.99
R5130:Slfn8	UTSW	11	83003821	missense	probably benign	0.35
R5165:Slfn8	UTSW	11	83017127	missense	probably damaging	0.99
R5238:Slfn8	UTSW	11	83013388	missense	probably damaging	0.96
R5282:Slfn8	UTSW	11	83017724	critical splice acceptor site	probably null
R5311:Slfn8	UTSW	11	83004084	missense	probably damaging	1.00
R5499:Slfn8	UTSW	11	83004216	missense	probably damaging	0.99
R5617:Slfn8	UTSW	11	83004721	missense	probably benign	0.01
R5782:Slfn8	UTSW	11	83017041	missense	probably damaging	0.98
R5823:Slfn8	UTSW	11	83016736	missense	probably benign	0.01
R5886:Slfn8	UTSW	11	83003334	missense	probably benign	0.09
R5933:Slfn8	UTSW	11	83003335	missense	probably benign	0.00
R6151:Slfn8	UTSW	11	83017321	missense	probably damaging	1.00
R6163:Slfn8	UTSW	11	83003864	makesense	probably null
R6191:Slfn8	UTSW	11	83016800	missense	possibly damaging	0.72
R6419:Slfn8	UTSW	11	83004055	splice site	probably null
R6925:Slfn8	UTSW	11	83013417	nonsense	probably null
R7065:Slfn8	UTSW	11	83016968	missense	probably benign	0.01
R7380:Slfn8	UTSW	11	83003740	missense	not run
R7414:Slfn8	UTSW	11	83016792	nonsense	probably null
R7819:Slfn8	UTSW	11	83004255	missense	probably damaging	1.00
R8425:Slfn8	UTSW	11	83004615	missense	possibly damaging	0.80
R8517:Slfn8	UTSW	11	83004142	missense	possibly damaging	0.68
R8804:Slfn8	UTSW	11	83016813	missense	possibly damaging	0.94
R8814:Slfn8	UTSW	11	83016679	missense	possibly damaging	0.95
R9069:Slfn8	UTSW	11	83017076	missense	probably damaging	1.00
R9233:Slfn8	UTSW	11	83003596	missense	probably damaging	1.00
R9457:Slfn8	UTSW	11	83017706	missense	probably benign
R9678:Slfn8	UTSW	11	83016897	missense	probably damaging	1.00
R9708:Slfn8	UTSW	11	83003441	missense	probably benign	0.00
R9764:Slfn8	UTSW	11	83017012	missense	probably damaging	1.00
X0021:Slfn8	UTSW	11	83016928	missense	possibly damaging	0.69
Z1177:Slfn8	UTSW	11	83003533	missense	probably benign	0.11

Predicted Primers

PCR Primer
(F):5'- AGCAGAACGGCTCTACTTTGATCAC -3'
(R):5'- CAGGCTTTCTTTGAGACCAAGCAAC -3'

Sequencing Primer
(F):5'- TGGGCATCCCAAGATGATTC -3'
(R):5'- CTGAAGATGGTTCTACTAAGCCTCG -3'

Posted On

2013-04-24