Mutagenetix > Incidental Mutations

Incidental Mutation 'R0368:Atp8a2'

30337

Institutional Source

Beutler Lab

Gene Symbol

Atp8a2

Ensembl Gene

ENSMUSG00000021983

Gene Name

ATPase, aminophospholipid transporter-like, class I, type 8A, member 2

Synonyms

wl, Ib

MMRRC Submission

038574-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.282) question?

Stock #

R0368 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59638540-60197179 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 59860212 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 789 (I789N)

Ref Sequence

ENSEMBL: ENSMUSP00000079238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080368]

Predicted Effect

probably damaging
Transcript: ENSMUST00000080368
AA Change: I789N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000079238
Gene: ENSMUSG00000021983
AA Change: I789N

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	14	80	2.3e-27	PFAM
Pfam:E1-E2_ATPase	85	348	6.7e-15	PFAM
Pfam:HAD	385	790	3.2e-22	PFAM
Pfam:Cation_ATPase	465	564	3.2e-14	PFAM
Pfam:PhoLip_ATPase_C	807	1059	2.8e-79	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.7%
20x: 90.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the P4 ATPase family of proteins, which are thought to be involved in a process called lipid flipping, whereby phospholipids are translocated inwards from the exoplasmic leaflet to the cytosolic leaflet of the cell membrane, which aids in generating and maintaining asymmetry in membrane lipids. This protein is predicted to contain an E1 E2 ATPase, a haloacid dehalogenase-like hydrolase (HAD) domain, and multiple transmembrane domains. Associations between this protein and cell cycle control protein 50A are important for translocation of phosphatidylserine across membranes. Mutations in this gene have been associated with cerebellar ataxia, mental retardation and disequilibrium syndrome (CAMRQ). In addition, a translocation breakpoint within this gene was observed in an individual with neurological dysfunction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygotes for spontaneous mutations have abnormal gait and tremors, with axonal degeneration in central and peripheral neurons. Symptoms progress to immobility and death by 1-month of age. Heterozygotes show subtle locomotor abnormalities and are hyporesponsive to tail pinching. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak	A	T	19: 9,008,350	K2333*	probably null	Het
Aox4	C	T	1: 58,213,079	L38F	probably benign	Het
Arhgef15	T	C	11: 68,954,693	E111G	probably damaging	Het
Cdca2	A	G	14: 67,700,347	S286P	possibly damaging	Het
Chrnb1	T	A	11: 69,784,757	K457M	probably damaging	Het
Clec2g	A	G	6: 128,980,261	I61V	possibly damaging	Het
Cyb5r3	G	A	15: 83,158,792	A233V	probably benign	Het
Cyp4a10	T	A	4: 115,525,377	L278*	probably null	Het
Dnmt1	T	C	9: 20,941,757	E56G	probably damaging	Het
Fam160b1	A	G	19: 57,368,578	T34A	possibly damaging	Het
Fam166a	T	A	2: 25,220,673	D164E	probably benign	Het
Fbln5	A	G	12: 101,809,714		probably null	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gabrr3	A	G	16: 59,440,596	D289G	probably damaging	Het
Gpr45	T	C	1: 43,033,016	L273P	probably damaging	Het
Hkdc1	T	C	10: 62,411,707	E125G	probably null	Het
Il25	A	G	14: 54,935,174		probably null	Het
Itfg1	A	T	8: 85,764,407	W298R	probably damaging	Het
Kank1	A	T	19: 25,410,603	K547*	probably null	Het
Lama5	G	A	2: 180,181,230	R2748*	probably null	Het
Lrp4	C	T	2: 91,477,734	T508I	probably damaging	Het
Map3k10	C	T	7: 27,663,360	V434I	probably damaging	Het
Map3k6	A	G	4: 133,252,659	M1265V	probably benign	Het
Mocs3	C	T	2: 168,231,682	P350S	probably benign	Het
Msh4	T	A	3: 153,888,825	Y113F	probably damaging	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Nrip1	A	G	16: 76,294,016	S218P	probably damaging	Het
Olfr1281	T	C	2: 111,328,787	Y123H	probably damaging	Het
Olfr1287	T	C	2: 111,449,788	I216T	probably benign	Het
Olig1	C	T	16: 91,270,652	S259F	probably damaging	Het
Osbpl9	A	G	4: 109,066,932	V499A	probably damaging	Het
Pafah2	T	C	4: 134,422,491	V371A	probably benign	Het
Pkp1	T	A	1: 135,875,683	M712L	probably benign	Het
Pkp1	T	C	1: 135,886,852	S244G	probably benign	Het
Ppp1r3a	T	C	6: 14,718,960	T652A	probably benign	Het
Rab21	A	T	10: 115,298,890	V108E	probably damaging	Het
Rab5b	C	T	10: 128,682,903	R120Q	probably benign	Het
Scd2	G	A	19: 44,301,246	V227I	probably benign	Het
Sema5b	T	A	16: 35,628,100	V82E	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Slc13a2	A	T	11: 78,404,800	L80*	probably null	Het
Slc1a5	C	T	7: 16,782,178	P93L	probably damaging	Het
Slc35b2	T	C	17: 45,566,463	V172A	probably benign	Het
Slfn8	A	G	11: 83,017,132	L195P	probably damaging	Het
Smox	G	A	2: 131,522,158	S320N	probably damaging	Het
Sptan1	T	C	2: 29,993,915	V589A	probably benign	Het
Stim2	G	A	5: 54,110,140		probably null	Het
V1ra8	A	G	6: 90,202,962	D49G	probably damaging	Het
Vmn1r233	A	T	17: 20,994,607	V27D	possibly damaging	Het
Vmn2r98	A	T	17: 19,065,827	K196*	probably null	Het
Wdr77	T	C	3: 105,962,066		probably null	Het

Other mutations in Atp8a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01289:Atp8a2	APN	14	59691461	missense	probably benign	0.00
IGL01505:Atp8a2	APN	14	60028063	missense	probably benign	0.00
IGL01614:Atp8a2	APN	14	60044988	missense	probably damaging	0.99
IGL01621:Atp8a2	APN	14	60015868	splice site	probably benign
IGL01634:Atp8a2	APN	14	59998062	missense	probably benign	0.01
IGL01672:Atp8a2	APN	14	59691533	missense	probably benign	0.01
IGL01898:Atp8a2	APN	14	60023513	missense	probably damaging	1.00
IGL01945:Atp8a2	APN	14	60026160	missense	probably damaging	1.00
IGL02006:Atp8a2	APN	14	59857048	missense	possibly damaging	0.90
IGL02089:Atp8a2	APN	14	60026920	splice site	probably null
IGL02211:Atp8a2	APN	14	60027976	missense	probably benign	0.00
IGL02283:Atp8a2	APN	14	60016799	missense	possibly damaging	0.86
IGL02337:Atp8a2	APN	14	59998002	missense	probably benign	0.32
IGL02571:Atp8a2	APN	14	60012458	splice site	probably benign
IGL02795:Atp8a2	APN	14	60033742	missense	probably damaging	0.96
IGL02874:Atp8a2	APN	14	59802252	missense	probably damaging	1.00
IGL02999:Atp8a2	APN	14	59925122	nonsense	probably null
IGL03307:Atp8a2	APN	14	60015872	critical splice donor site	probably null
IGL03345:Atp8a2	APN	14	59774011	missense	probably benign
PIT4431001:Atp8a2	UTSW	14	59654626	missense	probably benign
R0334:Atp8a2	UTSW	14	59691512	missense	probably damaging	1.00
R0420:Atp8a2	UTSW	14	59773744	missense	probably damaging	1.00
R0684:Atp8a2	UTSW	14	60023144	missense	probably benign	0.00
R0755:Atp8a2	UTSW	14	60009881	missense	possibly damaging	0.96
R0853:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R0908:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R0991:Atp8a2	UTSW	14	59793929	missense	probably benign	0.33
R1025:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1190:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1387:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1426:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1442:Atp8a2	UTSW	14	59860323	splice site	probably benign
R1472:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1538:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1573:Atp8a2	UTSW	14	59860206	missense	probably benign	0.00
R1620:Atp8a2	UTSW	14	59791183	missense	probably benign
R1661:Atp8a2	UTSW	14	59860186	missense	possibly damaging	0.80
R1673:Atp8a2	UTSW	14	59791240	missense	probably benign	0.00
R1749:Atp8a2	UTSW	14	59860174	nonsense	probably null
R1796:Atp8a2	UTSW	14	60020758	critical splice donor site	probably null
R1815:Atp8a2	UTSW	14	60086624	missense	probably damaging	1.00
R1836:Atp8a2	UTSW	14	60006366	missense	possibly damaging	0.49
R1935:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1936:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1937:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R2416:Atp8a2	UTSW	14	59925008	missense	probably damaging	1.00
R2760:Atp8a2	UTSW	14	59860192	missense	probably benign	0.43
R3029:Atp8a2	UTSW	14	59691465	frame shift	probably null
R3621:Atp8a2	UTSW	14	60026138	splice site	probably null
R3768:Atp8a2	UTSW	14	60044336	missense	probably benign	0.19
R3784:Atp8a2	UTSW	14	59773966	missense	probably damaging	1.00
R3896:Atp8a2	UTSW	14	60026140	critical splice donor site	probably null
R4009:Atp8a2	UTSW	14	60027985	missense	possibly damaging	0.54
R4591:Atp8a2	UTSW	14	59654629	missense	probably benign	0.03
R4866:Atp8a2	UTSW	14	59691467	missense	probably damaging	1.00
R4879:Atp8a2	UTSW	14	60008469	nonsense	probably null
R5059:Atp8a2	UTSW	14	59691537	missense	probably benign	0.00
R5529:Atp8a2	UTSW	14	59793865	critical splice donor site	probably null
R5788:Atp8a2	UTSW	14	60020793	missense	probably damaging	0.96
R6126:Atp8a2	UTSW	14	60044326	missense	probably benign
R6295:Atp8a2	UTSW	14	60012399	nonsense	probably null
R6393:Atp8a2	UTSW	14	59773755	nonsense	probably null
R6454:Atp8a2	UTSW	14	60008499	splice site	probably null
R6651:Atp8a2	UTSW	14	59774021	missense	probably benign	0.00
R6763:Atp8a2	UTSW	14	60008408	missense	probably benign	0.12
R6767:Atp8a2	UTSW	14	60046722	missense	probably damaging	1.00
R6912:Atp8a2	UTSW	14	60012410	missense	probably benign	0.33
R7032:Atp8a2	UTSW	14	60017840	intron	probably null
R7243:Atp8a2	UTSW	14	59647842	missense	probably benign
R7352:Atp8a2	UTSW	14	59791204	missense	probably benign
R7355:Atp8a2	UTSW	14	60045004	missense	possibly damaging	0.65
R7382:Atp8a2	UTSW	14	59654594	missense	probably benign	0.00
R7451:Atp8a2	UTSW	14	59791181	missense	probably null	0.00
R7483:Atp8a2	UTSW	14	60008375	missense	probably benign	0.00
R7516:Atp8a2	UTSW	14	59857067	missense	probably damaging	1.00
R7831:Atp8a2	UTSW	14	59773753	missense	probably damaging	0.99
R7914:Atp8a2	UTSW	14	59773753	missense	probably damaging	0.99
Z1088:Atp8a2	UTSW	14	60027970	missense	probably benign
Z1177:Atp8a2	UTSW	14	60006330	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- AGTCAGCAGGCACTTTCGGTTC -3'
(R):5'- CCTGGTAACCACCTTTGAATGCAGC -3'

Sequencing Primer
(F):5'- GCACTTTCGGTTCCTCTAGATG -3'
(R):5'- CCTTTGAATGCAGCCTGTGTG -3'

Posted On

2013-04-24