Incidental Mutation 'R0368:Atp8a2'
ID30337
Institutional Source Beutler Lab
Gene Symbol Atp8a2
Ensembl Gene ENSMUSG00000021983
Gene NameATPase, aminophospholipid transporter-like, class I, type 8A, member 2
Synonymswl, Ib
MMRRC Submission 038574-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R0368 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location59638540-60197179 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59860212 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 789 (I789N)
Ref Sequence ENSEMBL: ENSMUSP00000079238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080368]
Predicted Effect probably damaging
Transcript: ENSMUST00000080368
AA Change: I789N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079238
Gene: ENSMUSG00000021983
AA Change: I789N

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 14 80 2.3e-27 PFAM
Pfam:E1-E2_ATPase 85 348 6.7e-15 PFAM
Pfam:HAD 385 790 3.2e-22 PFAM
Pfam:Cation_ATPase 465 564 3.2e-14 PFAM
Pfam:PhoLip_ATPase_C 807 1059 2.8e-79 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the P4 ATPase family of proteins, which are thought to be involved in a process called lipid flipping, whereby phospholipids are translocated inwards from the exoplasmic leaflet to the cytosolic leaflet of the cell membrane, which aids in generating and maintaining asymmetry in membrane lipids. This protein is predicted to contain an E1 E2 ATPase, a haloacid dehalogenase-like hydrolase (HAD) domain, and multiple transmembrane domains. Associations between this protein and cell cycle control protein 50A are important for translocation of phosphatidylserine across membranes. Mutations in this gene have been associated with cerebellar ataxia, mental retardation and disequilibrium syndrome (CAMRQ). In addition, a translocation breakpoint within this gene was observed in an individual with neurological dysfunction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygotes for spontaneous mutations have abnormal gait and tremors, with axonal degeneration in central and peripheral neurons. Symptoms progress to immobility and death by 1-month of age. Heterozygotes show subtle locomotor abnormalities and are hyporesponsive to tail pinching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A T 19: 9,008,350 K2333* probably null Het
Aox4 C T 1: 58,213,079 L38F probably benign Het
Arhgef15 T C 11: 68,954,693 E111G probably damaging Het
Cdca2 A G 14: 67,700,347 S286P possibly damaging Het
Chrnb1 T A 11: 69,784,757 K457M probably damaging Het
Clec2g A G 6: 128,980,261 I61V possibly damaging Het
Cyb5r3 G A 15: 83,158,792 A233V probably benign Het
Cyp4a10 T A 4: 115,525,377 L278* probably null Het
Dnmt1 T C 9: 20,941,757 E56G probably damaging Het
Fam160b1 A G 19: 57,368,578 T34A possibly damaging Het
Fam166a T A 2: 25,220,673 D164E probably benign Het
Fbln5 A G 12: 101,809,714 probably null Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gabrr3 A G 16: 59,440,596 D289G probably damaging Het
Gpr45 T C 1: 43,033,016 L273P probably damaging Het
Hkdc1 T C 10: 62,411,707 E125G probably null Het
Il25 A G 14: 54,935,174 probably null Het
Itfg1 A T 8: 85,764,407 W298R probably damaging Het
Kank1 A T 19: 25,410,603 K547* probably null Het
Lama5 G A 2: 180,181,230 R2748* probably null Het
Lrp4 C T 2: 91,477,734 T508I probably damaging Het
Map3k10 C T 7: 27,663,360 V434I probably damaging Het
Map3k6 A G 4: 133,252,659 M1265V probably benign Het
Mocs3 C T 2: 168,231,682 P350S probably benign Het
Msh4 T A 3: 153,888,825 Y113F probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nrip1 A G 16: 76,294,016 S218P probably damaging Het
Olfr1281 T C 2: 111,328,787 Y123H probably damaging Het
Olfr1287 T C 2: 111,449,788 I216T probably benign Het
Olig1 C T 16: 91,270,652 S259F probably damaging Het
Osbpl9 A G 4: 109,066,932 V499A probably damaging Het
Pafah2 T C 4: 134,422,491 V371A probably benign Het
Pkp1 T A 1: 135,875,683 M712L probably benign Het
Pkp1 T C 1: 135,886,852 S244G probably benign Het
Ppp1r3a T C 6: 14,718,960 T652A probably benign Het
Rab21 A T 10: 115,298,890 V108E probably damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Scd2 G A 19: 44,301,246 V227I probably benign Het
Sema5b T A 16: 35,628,100 V82E probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Slc13a2 A T 11: 78,404,800 L80* probably null Het
Slc1a5 C T 7: 16,782,178 P93L probably damaging Het
Slc35b2 T C 17: 45,566,463 V172A probably benign Het
Slfn8 A G 11: 83,017,132 L195P probably damaging Het
Smox G A 2: 131,522,158 S320N probably damaging Het
Sptan1 T C 2: 29,993,915 V589A probably benign Het
Stim2 G A 5: 54,110,140 probably null Het
V1ra8 A G 6: 90,202,962 D49G probably damaging Het
Vmn1r233 A T 17: 20,994,607 V27D possibly damaging Het
Vmn2r98 A T 17: 19,065,827 K196* probably null Het
Wdr77 T C 3: 105,962,066 probably null Het
Other mutations in Atp8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Atp8a2 APN 14 59691461 missense probably benign 0.00
IGL01505:Atp8a2 APN 14 60028063 missense probably benign 0.00
IGL01614:Atp8a2 APN 14 60044988 missense probably damaging 0.99
IGL01621:Atp8a2 APN 14 60015868 splice site probably benign
IGL01634:Atp8a2 APN 14 59998062 missense probably benign 0.01
IGL01672:Atp8a2 APN 14 59691533 missense probably benign 0.01
IGL01898:Atp8a2 APN 14 60023513 missense probably damaging 1.00
IGL01945:Atp8a2 APN 14 60026160 missense probably damaging 1.00
IGL02006:Atp8a2 APN 14 59857048 missense possibly damaging 0.90
IGL02089:Atp8a2 APN 14 60026920 splice site probably null
IGL02211:Atp8a2 APN 14 60027976 missense probably benign 0.00
IGL02283:Atp8a2 APN 14 60016799 missense possibly damaging 0.86
IGL02337:Atp8a2 APN 14 59998002 missense probably benign 0.32
IGL02571:Atp8a2 APN 14 60012458 splice site probably benign
IGL02795:Atp8a2 APN 14 60033742 missense probably damaging 0.96
IGL02874:Atp8a2 APN 14 59802252 missense probably damaging 1.00
IGL02999:Atp8a2 APN 14 59925122 nonsense probably null
IGL03307:Atp8a2 APN 14 60015872 critical splice donor site probably null
IGL03345:Atp8a2 APN 14 59774011 missense probably benign
PIT4431001:Atp8a2 UTSW 14 59654626 missense probably benign
R0334:Atp8a2 UTSW 14 59691512 missense probably damaging 1.00
R0420:Atp8a2 UTSW 14 59773744 missense probably damaging 1.00
R0684:Atp8a2 UTSW 14 60023144 missense probably benign 0.00
R0755:Atp8a2 UTSW 14 60009881 missense possibly damaging 0.96
R0853:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R0908:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R0991:Atp8a2 UTSW 14 59793929 missense probably benign 0.33
R1025:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1190:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1387:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1426:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1442:Atp8a2 UTSW 14 59860323 splice site probably benign
R1472:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1538:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1573:Atp8a2 UTSW 14 59860206 missense probably benign 0.00
R1620:Atp8a2 UTSW 14 59791183 missense probably benign
R1661:Atp8a2 UTSW 14 59860186 missense possibly damaging 0.80
R1673:Atp8a2 UTSW 14 59791240 missense probably benign 0.00
R1749:Atp8a2 UTSW 14 59860174 nonsense probably null
R1796:Atp8a2 UTSW 14 60020758 critical splice donor site probably null
R1815:Atp8a2 UTSW 14 60086624 missense probably damaging 1.00
R1836:Atp8a2 UTSW 14 60006366 missense possibly damaging 0.49
R1935:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1936:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1937:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R2416:Atp8a2 UTSW 14 59925008 missense probably damaging 1.00
R2760:Atp8a2 UTSW 14 59860192 missense probably benign 0.43
R3029:Atp8a2 UTSW 14 59691465 frame shift probably null
R3621:Atp8a2 UTSW 14 60026138 splice site probably null
R3768:Atp8a2 UTSW 14 60044336 missense probably benign 0.19
R3784:Atp8a2 UTSW 14 59773966 missense probably damaging 1.00
R3896:Atp8a2 UTSW 14 60026140 critical splice donor site probably null
R4009:Atp8a2 UTSW 14 60027985 missense possibly damaging 0.54
R4591:Atp8a2 UTSW 14 59654629 missense probably benign 0.03
R4866:Atp8a2 UTSW 14 59691467 missense probably damaging 1.00
R4879:Atp8a2 UTSW 14 60008469 nonsense probably null
R5059:Atp8a2 UTSW 14 59691537 missense probably benign 0.00
R5529:Atp8a2 UTSW 14 59793865 critical splice donor site probably null
R5788:Atp8a2 UTSW 14 60020793 missense probably damaging 0.96
R6126:Atp8a2 UTSW 14 60044326 missense probably benign
R6295:Atp8a2 UTSW 14 60012399 nonsense probably null
R6393:Atp8a2 UTSW 14 59773755 nonsense probably null
R6454:Atp8a2 UTSW 14 60008499 splice site probably null
R6651:Atp8a2 UTSW 14 59774021 missense probably benign 0.00
R6763:Atp8a2 UTSW 14 60008408 missense probably benign 0.12
R6767:Atp8a2 UTSW 14 60046722 missense probably damaging 1.00
R6912:Atp8a2 UTSW 14 60012410 missense probably benign 0.33
R7032:Atp8a2 UTSW 14 60017840 intron probably null
R7243:Atp8a2 UTSW 14 59647842 missense probably benign
R7352:Atp8a2 UTSW 14 59791204 missense probably benign
R7355:Atp8a2 UTSW 14 60045004 missense possibly damaging 0.65
R7382:Atp8a2 UTSW 14 59654594 missense probably benign 0.00
R7451:Atp8a2 UTSW 14 59791181 missense probably null 0.00
R7483:Atp8a2 UTSW 14 60008375 missense probably benign 0.00
R7516:Atp8a2 UTSW 14 59857067 missense probably damaging 1.00
R7831:Atp8a2 UTSW 14 59773753 missense probably damaging 0.99
R7914:Atp8a2 UTSW 14 59773753 missense probably damaging 0.99
Z1088:Atp8a2 UTSW 14 60027970 missense probably benign
Z1177:Atp8a2 UTSW 14 60006330 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGTCAGCAGGCACTTTCGGTTC -3'
(R):5'- CCTGGTAACCACCTTTGAATGCAGC -3'

Sequencing Primer
(F):5'- GCACTTTCGGTTCCTCTAGATG -3'
(R):5'- CCTTTGAATGCAGCCTGTGTG -3'
Posted On2013-04-24