Incidental Mutation 'R0368:Cdca2'
ID 30338
Institutional Source Beutler Lab
Gene Symbol Cdca2
Ensembl Gene ENSMUSG00000048922
Gene Name cell division cycle associated 2
Synonyms 2610311M19Rik
MMRRC Submission 038574-MU
Accession Numbers

Genbank: NM_001110162, NM_175384

Essential gene? Probably non essential (E-score: 0.113) question?
Stock # R0368 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 67676331-67715841 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67700347 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 286 (S286P)
Ref Sequence ENSEMBL: ENSMUSP00000116384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124045] [ENSMUST00000132705] [ENSMUST00000150006] [ENSMUST00000163100]
AlphaFold Q14B71
Predicted Effect possibly damaging
Transcript: ENSMUST00000124045
AA Change: S286P

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000130922
Predicted Effect probably benign
Transcript: ENSMUST00000131179
SMART Domains Protein: ENSMUSP00000123664
Gene: ENSMUSG00000048922

DomainStartEndE-ValueType
low complexity region 70 83 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132705
AA Change: S286P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000115633
Gene: ENSMUSG00000048922
AA Change: S286P

DomainStartEndE-ValueType
Pfam:PP1_bind 378 437 4.3e-28 PFAM
low complexity region 515 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150006
AA Change: S286P

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000117847
Gene: ENSMUSG00000048922
AA Change: S286P

DomainStartEndE-ValueType
Pfam:PP1_bind 378 437 5.4e-28 PFAM
low complexity region 515 528 N/A INTRINSIC
low complexity region 542 556 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155312
Predicted Effect probably benign
Transcript: ENSMUST00000163100
AA Change: S286P

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127571
Gene: ENSMUSG00000048922
AA Change: S286P

DomainStartEndE-ValueType
Pfam:PP1_bind 379 436 4.1e-27 PFAM
low complexity region 515 528 N/A INTRINSIC
low complexity region 542 556 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a targeting subunit of the cell-cycle associated protein, protein phosphatase 1, with a role in targeting this protein to chromatin during anaphase. These two proteins comprise a phosphatase complex that is involved in nuclear envelope reformation and regulation of the DNA damage response. The encoded protein may also play a role in cancer progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(24) : Gene trapped(24)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A T 19: 9,008,350 K2333* probably null Het
Aox4 C T 1: 58,213,079 L38F probably benign Het
Arhgef15 T C 11: 68,954,693 E111G probably damaging Het
Atp8a2 A T 14: 59,860,212 I789N probably damaging Het
Chrnb1 T A 11: 69,784,757 K457M probably damaging Het
Clec2g A G 6: 128,980,261 I61V possibly damaging Het
Cyb5r3 G A 15: 83,158,792 A233V probably benign Het
Cyp4a10 T A 4: 115,525,377 L278* probably null Het
Dnmt1 T C 9: 20,941,757 E56G probably damaging Het
Fam160b1 A G 19: 57,368,578 T34A possibly damaging Het
Fam166a T A 2: 25,220,673 D164E probably benign Het
Fbln5 A G 12: 101,809,714 probably null Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gabrr3 A G 16: 59,440,596 D289G probably damaging Het
Gpr45 T C 1: 43,033,016 L273P probably damaging Het
Hkdc1 T C 10: 62,411,707 E125G probably null Het
Il25 A G 14: 54,935,174 probably null Het
Itfg1 A T 8: 85,764,407 W298R probably damaging Het
Kank1 A T 19: 25,410,603 K547* probably null Het
Lama5 G A 2: 180,181,230 R2748* probably null Het
Lrp4 C T 2: 91,477,734 T508I probably damaging Het
Map3k10 C T 7: 27,663,360 V434I probably damaging Het
Map3k6 A G 4: 133,252,659 M1265V probably benign Het
Mocs3 C T 2: 168,231,682 P350S probably benign Het
Msh4 T A 3: 153,888,825 Y113F probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nrip1 A G 16: 76,294,016 S218P probably damaging Het
Olfr1281 T C 2: 111,328,787 Y123H probably damaging Het
Olfr1287 T C 2: 111,449,788 I216T probably benign Het
Olig1 C T 16: 91,270,652 S259F probably damaging Het
Osbpl9 A G 4: 109,066,932 V499A probably damaging Het
Pafah2 T C 4: 134,422,491 V371A probably benign Het
Pkp1 T A 1: 135,875,683 M712L probably benign Het
Pkp1 T C 1: 135,886,852 S244G probably benign Het
Ppp1r3a T C 6: 14,718,960 T652A probably benign Het
Rab21 A T 10: 115,298,890 V108E probably damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Scd2 G A 19: 44,301,246 V227I probably benign Het
Sema5b T A 16: 35,628,100 V82E probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Slc13a2 A T 11: 78,404,800 L80* probably null Het
Slc1a5 C T 7: 16,782,178 P93L probably damaging Het
Slc35b2 T C 17: 45,566,463 V172A probably benign Het
Slfn8 A G 11: 83,017,132 L195P probably damaging Het
Smox G A 2: 131,522,158 S320N probably damaging Het
Sptan1 T C 2: 29,993,915 V589A probably benign Het
Stim2 G A 5: 54,110,140 probably null Het
V1ra8 A G 6: 90,202,962 D49G probably damaging Het
Vmn1r233 A T 17: 20,994,607 V27D possibly damaging Het
Vmn2r98 A T 17: 19,065,827 K196* probably null Het
Wdr77 T C 3: 105,962,066 probably null Het
Other mutations in Cdca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Cdca2 APN 14 67714697 missense probably damaging 0.99
IGL01413:Cdca2 APN 14 67677894 missense probably damaging 0.98
IGL01962:Cdca2 APN 14 67705723 missense probably damaging 0.99
IGL01982:Cdca2 APN 14 67677719 missense probably damaging 0.98
IGL02198:Cdca2 APN 14 67694996 missense probably benign 0.00
IGL02208:Cdca2 APN 14 67713140 missense probably damaging 0.99
IGL02883:Cdca2 APN 14 67707497 missense probably damaging 1.00
IGL03069:Cdca2 APN 14 67714936 splice site probably benign
F5493:Cdca2 UTSW 14 67677692 missense probably damaging 0.99
IGL03046:Cdca2 UTSW 14 67700022 intron probably benign
R0254:Cdca2 UTSW 14 67677178 missense probably damaging 0.99
R0350:Cdca2 UTSW 14 67713119 missense probably benign 0.02
R0398:Cdca2 UTSW 14 67697962 missense probably damaging 0.98
R0790:Cdca2 UTSW 14 67680291 missense probably benign
R1104:Cdca2 UTSW 14 67693682 missense probably damaging 0.99
R1474:Cdca2 UTSW 14 67714906 intron probably benign
R1658:Cdca2 UTSW 14 67677699 missense possibly damaging 0.93
R1782:Cdca2 UTSW 14 67677811 missense probably benign 0.22
R2150:Cdca2 UTSW 14 67714809 missense probably damaging 1.00
R2154:Cdca2 UTSW 14 67676976 missense probably damaging 0.99
R2155:Cdca2 UTSW 14 67714838 missense probably damaging 1.00
R2862:Cdca2 UTSW 14 67698090 missense probably damaging 1.00
R3156:Cdca2 UTSW 14 67698163 missense possibly damaging 0.91
R3840:Cdca2 UTSW 14 67680271 nonsense probably null
R4043:Cdca2 UTSW 14 67704006 missense probably benign 0.11
R4293:Cdca2 UTSW 14 67714850 missense probably benign 0.06
R4679:Cdca2 UTSW 14 67714966 missense possibly damaging 0.68
R4777:Cdca2 UTSW 14 67713140 missense probably damaging 0.99
R4829:Cdca2 UTSW 14 67693753 critical splice acceptor site probably null
R4843:Cdca2 UTSW 14 67676976 missense probably damaging 1.00
R5031:Cdca2 UTSW 14 67713153 missense probably damaging 1.00
R5181:Cdca2 UTSW 14 67680165 missense probably damaging 0.98
R5331:Cdca2 UTSW 14 67677471 missense possibly damaging 0.91
R5490:Cdca2 UTSW 14 67680284 missense possibly damaging 0.91
R5695:Cdca2 UTSW 14 67705629 critical splice donor site probably null
R6246:Cdca2 UTSW 14 67677828 nonsense probably null
R6866:Cdca2 UTSW 14 67693666 missense possibly damaging 0.92
R6928:Cdca2 UTSW 14 67705744 missense probably damaging 0.98
R6955:Cdca2 UTSW 14 67715004 start codon destroyed probably null 0.53
R6986:Cdca2 UTSW 14 67694997 missense probably benign 0.27
R7080:Cdca2 UTSW 14 67698102 missense probably damaging 0.99
R7092:Cdca2 UTSW 14 67707351 critical splice donor site probably null
R7292:Cdca2 UTSW 14 67677877 nonsense probably null
R7308:Cdca2 UTSW 14 67694991 missense probably benign
R7310:Cdca2 UTSW 14 67713224 missense probably damaging 1.00
R7877:Cdca2 UTSW 14 67677216 missense probably benign
R8012:Cdca2 UTSW 14 67677372 missense probably benign 0.23
R8080:Cdca2 UTSW 14 67677555 nonsense probably null
R8772:Cdca2 UTSW 14 67698080 missense probably damaging 0.98
R9123:Cdca2 UTSW 14 67680313 missense probably benign 0.03
R9125:Cdca2 UTSW 14 67680313 missense probably benign 0.03
R9252:Cdca2 UTSW 14 67677382 missense possibly damaging 0.93
R9328:Cdca2 UTSW 14 67693682 missense probably damaging 0.99
R9406:Cdca2 UTSW 14 67700323 missense unknown
R9667:Cdca2 UTSW 14 67677554 missense probably benign 0.01
R9678:Cdca2 UTSW 14 67700329 missense unknown
Z1088:Cdca2 UTSW 14 67700298 missense probably benign 0.12
Z1177:Cdca2 UTSW 14 67680244 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACACCAGTGTGACACATGGA -3'
(R):5'- ACCGTCTTGGTAAGTGTTGTGAGTATCT -3'

Sequencing Primer
(F):5'- AGTGTGACACATGGATCTCC -3'
(R):5'- ATCTTGTGCCTGGAAGGAGC -3'
Posted On 2013-04-24