Incidental Mutation 'R0368:Gabrr3'
ID 30342
Institutional Source Beutler Lab
Gene Symbol Gabrr3
Ensembl Gene ENSMUSG00000074991
Gene Name gamma-aminobutyric acid type A receptor subunit rho 3
Synonyms
MMRRC Submission 038574-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R0368 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 59227745-59282102 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59260959 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 289 (D289G)
Ref Sequence ENSEMBL: ENSMUSP00000109980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114341]
AlphaFold B2RXA8
Predicted Effect probably damaging
Transcript: ENSMUST00000114341
AA Change: D289G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109980
Gene: ENSMUSG00000074991
AA Change: D289G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Neur_chan_LBD 57 264 3.8e-55 PFAM
Pfam:Neur_chan_memb 271 426 8.6e-31 PFAM
transmembrane domain 446 463 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The neurotransmitter gamma-aminobutyric acid (GABA) functions in the central nervous system to regulate synaptic transmission of neurons. This gene encodes one of three related subunits, which combine as homo- or hetero-pentamers to form GABA(C) receptors. In humans, some individuals contain a single-base polymorphism (dbSNP rs832032) that is predicted to inactivate the gene product. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A T 19: 8,985,714 (GRCm39) K2333* probably null Het
Aox4 C T 1: 58,252,238 (GRCm39) L38F probably benign Het
Arhgef15 T C 11: 68,845,519 (GRCm39) E111G probably damaging Het
Atp8a2 A T 14: 60,097,661 (GRCm39) I789N probably damaging Het
Cdca2 A G 14: 67,937,796 (GRCm39) S286P possibly damaging Het
Chrnb1 T A 11: 69,675,583 (GRCm39) K457M probably damaging Het
Cimip2a T A 2: 25,110,685 (GRCm39) D164E probably benign Het
Clec2g A G 6: 128,957,224 (GRCm39) I61V possibly damaging Het
Cyb5r3 G A 15: 83,042,993 (GRCm39) A233V probably benign Het
Cyp4a10 T A 4: 115,382,574 (GRCm39) L278* probably null Het
Dnmt1 T C 9: 20,853,053 (GRCm39) E56G probably damaging Het
Fbln5 A G 12: 101,775,973 (GRCm39) probably null Het
Fhip2a A G 19: 57,357,010 (GRCm39) T34A possibly damaging Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gpr45 T C 1: 43,072,176 (GRCm39) L273P probably damaging Het
Hkdc1 T C 10: 62,247,486 (GRCm39) E125G probably null Het
Il25 A G 14: 55,172,631 (GRCm39) probably null Het
Itfg1 A T 8: 86,491,036 (GRCm39) W298R probably damaging Het
Kank1 A T 19: 25,387,967 (GRCm39) K547* probably null Het
Lama5 G A 2: 179,823,023 (GRCm39) R2748* probably null Het
Lrp4 C T 2: 91,308,079 (GRCm39) T508I probably damaging Het
Map3k10 C T 7: 27,362,785 (GRCm39) V434I probably damaging Het
Map3k6 A G 4: 132,979,970 (GRCm39) M1265V probably benign Het
Mocs3 C T 2: 168,073,602 (GRCm39) P350S probably benign Het
Msh4 T A 3: 153,594,462 (GRCm39) Y113F probably damaging Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Nrip1 A G 16: 76,090,904 (GRCm39) S218P probably damaging Het
Olig1 C T 16: 91,067,540 (GRCm39) S259F probably damaging Het
Or4k37 T C 2: 111,159,132 (GRCm39) Y123H probably damaging Het
Or4k41 T C 2: 111,280,133 (GRCm39) I216T probably benign Het
Osbpl9 A G 4: 108,924,129 (GRCm39) V499A probably damaging Het
Pafah2 T C 4: 134,149,802 (GRCm39) V371A probably benign Het
Pkp1 T A 1: 135,803,421 (GRCm39) M712L probably benign Het
Pkp1 T C 1: 135,814,590 (GRCm39) S244G probably benign Het
Ppp1r3a T C 6: 14,718,959 (GRCm39) T652A probably benign Het
Rab21 A T 10: 115,134,795 (GRCm39) V108E probably damaging Het
Rab5b C T 10: 128,518,772 (GRCm39) R120Q probably benign Het
Scd2 G A 19: 44,289,685 (GRCm39) V227I probably benign Het
Sema5b T A 16: 35,448,470 (GRCm39) V82E probably damaging Het
Sema6a G A 18: 47,423,112 (GRCm39) probably null Het
Slc13a2 A T 11: 78,295,626 (GRCm39) L80* probably null Het
Slc1a5 C T 7: 16,516,103 (GRCm39) P93L probably damaging Het
Slc35b2 T C 17: 45,877,389 (GRCm39) V172A probably benign Het
Slfn8 A G 11: 82,907,958 (GRCm39) L195P probably damaging Het
Smox G A 2: 131,364,078 (GRCm39) S320N probably damaging Het
Sptan1 T C 2: 29,883,927 (GRCm39) V589A probably benign Het
Stim2 G A 5: 54,267,482 (GRCm39) probably null Het
V1ra8 A G 6: 90,179,944 (GRCm39) D49G probably damaging Het
Vmn1r233 A T 17: 21,214,869 (GRCm39) V27D possibly damaging Het
Vmn2r98 A T 17: 19,286,089 (GRCm39) K196* probably null Het
Wdr77 T C 3: 105,869,382 (GRCm39) probably null Het
Other mutations in Gabrr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02816:Gabrr3 APN 16 59,260,830 (GRCm39) splice site probably benign
IGL02989:Gabrr3 APN 16 59,268,371 (GRCm39) missense probably damaging 0.98
IGL03048:Gabrr3 UTSW 16 59,250,493 (GRCm39) missense probably benign 0.00
PIT4791001:Gabrr3 UTSW 16 59,250,298 (GRCm39) critical splice acceptor site probably null
R0976:Gabrr3 UTSW 16 59,281,887 (GRCm39) missense probably benign 0.34
R1104:Gabrr3 UTSW 16 59,281,998 (GRCm39) missense probably damaging 0.98
R1231:Gabrr3 UTSW 16 59,281,763 (GRCm39) missense probably benign 0.01
R1556:Gabrr3 UTSW 16 59,281,763 (GRCm39) missense probably benign 0.01
R2181:Gabrr3 UTSW 16 59,268,372 (GRCm39) missense probably damaging 0.98
R2185:Gabrr3 UTSW 16 59,255,031 (GRCm39) missense probably damaging 1.00
R2336:Gabrr3 UTSW 16 59,250,313 (GRCm39) missense probably damaging 1.00
R3941:Gabrr3 UTSW 16 59,253,864 (GRCm39) missense probably damaging 1.00
R4572:Gabrr3 UTSW 16 59,282,001 (GRCm39) missense probably benign 0.09
R4747:Gabrr3 UTSW 16 59,268,277 (GRCm39) splice site probably null
R4786:Gabrr3 UTSW 16 59,250,463 (GRCm39) missense probably benign 0.44
R4845:Gabrr3 UTSW 16 59,246,833 (GRCm39) missense probably damaging 0.99
R5539:Gabrr3 UTSW 16 59,281,758 (GRCm39) missense probably benign
R5543:Gabrr3 UTSW 16 59,253,870 (GRCm39) missense probably damaging 1.00
R5979:Gabrr3 UTSW 16 59,254,931 (GRCm39) missense possibly damaging 0.81
R6211:Gabrr3 UTSW 16 59,268,471 (GRCm39) missense probably benign
R7338:Gabrr3 UTSW 16 59,268,439 (GRCm39) missense possibly damaging 0.70
R7456:Gabrr3 UTSW 16 59,227,853 (GRCm39) nonsense probably null
R8673:Gabrr3 UTSW 16 59,235,633 (GRCm39) missense possibly damaging 0.55
R9001:Gabrr3 UTSW 16 59,282,008 (GRCm39) missense probably benign 0.01
R9139:Gabrr3 UTSW 16 59,227,830 (GRCm39) missense probably benign 0.12
R9378:Gabrr3 UTSW 16 59,282,037 (GRCm39) missense possibly damaging 0.78
Z1176:Gabrr3 UTSW 16 59,227,845 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAAGAGCTGCTGCTGAGTAAG -3'
(R):5'- AGCCGTATCCTGACGAATCTCTCC -3'

Sequencing Primer
(F):5'- CACGGTCTATGTCTCTGAGAGC -3'
(R):5'- GAATCTCTCCTTGCTTCTCCATATAG -3'
Posted On 2013-04-24