Incidental Mutation 'R0368:Nrip1'
ID30343
Institutional Source Beutler Lab
Gene Symbol Nrip1
Ensembl Gene ENSMUSG00000048490
Gene Namenuclear receptor interacting protein 1
SynonymsRIP140, 6030458L20Rik, 8430438I05Rik
MMRRC Submission 038574-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0368 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location76287400-76373827 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76294016 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 218 (S218P)
Ref Sequence ENSEMBL: ENSMUSP00000112959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054178] [ENSMUST00000121927] [ENSMUST00000140483] [ENSMUST00000231585]
Predicted Effect probably damaging
Transcript: ENSMUST00000054178
AA Change: S218P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051726
Gene: ENSMUSG00000048490
AA Change: S218P

DomainStartEndE-ValueType
low complexity region 182 195 N/A INTRINSIC
low complexity region 252 261 N/A INTRINSIC
PDB:2GPP|D 368 392 2e-7 PDB
low complexity region 707 718 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121927
AA Change: S218P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112959
Gene: ENSMUSG00000048490
AA Change: S218P

DomainStartEndE-ValueType
Pfam:NRIP1_repr_1 27 331 5.4e-141 PFAM
PDB:2GPP|D 368 392 2e-7 PDB
Pfam:NRIP1_repr_2 412 739 7.5e-122 PFAM
Pfam:NRIP1_repr_3 754 841 8.4e-45 PFAM
Pfam:NRIP1_repr_4 849 1161 1.7e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231304
Predicted Effect probably benign
Transcript: ENSMUST00000231585
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear receptor interacting protein 1 (NRIP1) is a nuclear protein that specifically interacts with the hormone-dependent activation domain AF2 of nuclear receptors. Also known as RIP140, this protein modulates transcriptional activity of the estrogen receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygosity for targeted disruption of this gene results in female infertility due to ovulation failure. Heterozygous females are partially affected. Male and female mice are smaller than wild-type littermates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A T 19: 9,008,350 K2333* probably null Het
Aox4 C T 1: 58,213,079 L38F probably benign Het
Arhgef15 T C 11: 68,954,693 E111G probably damaging Het
Atp8a2 A T 14: 59,860,212 I789N probably damaging Het
Cdca2 A G 14: 67,700,347 S286P possibly damaging Het
Chrnb1 T A 11: 69,784,757 K457M probably damaging Het
Clec2g A G 6: 128,980,261 I61V possibly damaging Het
Cyb5r3 G A 15: 83,158,792 A233V probably benign Het
Cyp4a10 T A 4: 115,525,377 L278* probably null Het
Dnmt1 T C 9: 20,941,757 E56G probably damaging Het
Fam160b1 A G 19: 57,368,578 T34A possibly damaging Het
Fam166a T A 2: 25,220,673 D164E probably benign Het
Fbln5 A G 12: 101,809,714 probably null Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gabrr3 A G 16: 59,440,596 D289G probably damaging Het
Gpr45 T C 1: 43,033,016 L273P probably damaging Het
Hkdc1 T C 10: 62,411,707 E125G probably null Het
Il25 A G 14: 54,935,174 probably null Het
Itfg1 A T 8: 85,764,407 W298R probably damaging Het
Kank1 A T 19: 25,410,603 K547* probably null Het
Lama5 G A 2: 180,181,230 R2748* probably null Het
Lrp4 C T 2: 91,477,734 T508I probably damaging Het
Map3k10 C T 7: 27,663,360 V434I probably damaging Het
Map3k6 A G 4: 133,252,659 M1265V probably benign Het
Mocs3 C T 2: 168,231,682 P350S probably benign Het
Msh4 T A 3: 153,888,825 Y113F probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Olfr1281 T C 2: 111,328,787 Y123H probably damaging Het
Olfr1287 T C 2: 111,449,788 I216T probably benign Het
Olig1 C T 16: 91,270,652 S259F probably damaging Het
Osbpl9 A G 4: 109,066,932 V499A probably damaging Het
Pafah2 T C 4: 134,422,491 V371A probably benign Het
Pkp1 T A 1: 135,875,683 M712L probably benign Het
Pkp1 T C 1: 135,886,852 S244G probably benign Het
Ppp1r3a T C 6: 14,718,960 T652A probably benign Het
Rab21 A T 10: 115,298,890 V108E probably damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Scd2 G A 19: 44,301,246 V227I probably benign Het
Sema5b T A 16: 35,628,100 V82E probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Slc13a2 A T 11: 78,404,800 L80* probably null Het
Slc1a5 C T 7: 16,782,178 P93L probably damaging Het
Slc35b2 T C 17: 45,566,463 V172A probably benign Het
Slfn8 A G 11: 83,017,132 L195P probably damaging Het
Smox G A 2: 131,522,158 S320N probably damaging Het
Sptan1 T C 2: 29,993,915 V589A probably benign Het
Stim2 G A 5: 54,110,140 probably null Het
V1ra8 A G 6: 90,202,962 D49G probably damaging Het
Vmn1r233 A T 17: 20,994,607 V27D possibly damaging Het
Vmn2r98 A T 17: 19,065,827 K196* probably null Het
Wdr77 T C 3: 105,962,066 probably null Het
Other mutations in Nrip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Nrip1 APN 16 76293703 missense possibly damaging 0.48
IGL00732:Nrip1 APN 16 76293061 missense probably benign 0.31
IGL02024:Nrip1 APN 16 76291675 missense probably benign 0.05
IGL02172:Nrip1 APN 16 76291492 missense probably damaging 0.99
IGL02432:Nrip1 APN 16 76291780 missense probably benign 0.04
IGL03025:Nrip1 APN 16 76294465 missense probably benign 0.06
IGL03410:Nrip1 APN 16 76292491 missense probably benign
PIT4802001:Nrip1 UTSW 16 76293269 missense probably damaging 0.97
R0064:Nrip1 UTSW 16 76294670 utr 5 prime probably benign
R0304:Nrip1 UTSW 16 76292707 missense possibly damaging 0.67
R0320:Nrip1 UTSW 16 76292363 missense probably benign 0.00
R1730:Nrip1 UTSW 16 76292890 missense probably benign 0.42
R1783:Nrip1 UTSW 16 76292890 missense probably benign 0.42
R1850:Nrip1 UTSW 16 76293344 missense probably damaging 1.00
R1900:Nrip1 UTSW 16 76292039 missense probably benign
R2252:Nrip1 UTSW 16 76291285 missense probably damaging 1.00
R3935:Nrip1 UTSW 16 76294435 missense possibly damaging 0.67
R4290:Nrip1 UTSW 16 76291988 missense probably benign 0.00
R4426:Nrip1 UTSW 16 76291405 missense possibly damaging 0.87
R4598:Nrip1 UTSW 16 76293080 missense probably damaging 1.00
R4607:Nrip1 UTSW 16 76293032 missense probably benign 0.00
R4608:Nrip1 UTSW 16 76293032 missense probably benign 0.00
R5893:Nrip1 UTSW 16 76293953 missense probably damaging 1.00
R5939:Nrip1 UTSW 16 76292122 missense probably damaging 0.99
R5966:Nrip1 UTSW 16 76293583 missense possibly damaging 0.47
R6093:Nrip1 UTSW 16 76294764 start gained probably benign
R6154:Nrip1 UTSW 16 76293830 missense probably damaging 1.00
R6639:Nrip1 UTSW 16 76293995 nonsense probably null
R6910:Nrip1 UTSW 16 76294417 missense probably damaging 1.00
R6921:Nrip1 UTSW 16 76292588 missense possibly damaging 0.88
R7314:Nrip1 UTSW 16 76291190 missense probably benign 0.00
R7346:Nrip1 UTSW 16 76293356 missense possibly damaging 0.81
R7386:Nrip1 UTSW 16 76293887 missense probably damaging 1.00
R7485:Nrip1 UTSW 16 76291450 missense probably damaging 1.00
R7506:Nrip1 UTSW 16 76294459 missense probably damaging 1.00
R7517:Nrip1 UTSW 16 76291184 makesense probably null
R7657:Nrip1 UTSW 16 76294699 utr 5 prime probably null
R7878:Nrip1 UTSW 16 76294666 start codon destroyed probably null 0.99
R7961:Nrip1 UTSW 16 76294666 start codon destroyed probably null 0.99
R8068:Nrip1 UTSW 16 76292953 missense possibly damaging 0.62
Z1177:Nrip1 UTSW 16 76293479 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAACACCCATTGGACTCTGAAAGG -3'
(R):5'- CTGTCACAGCAGATTAGACAGAGCC -3'

Sequencing Primer
(F):5'- CATGTTCCCGAGAGTACTGCTG -3'
(R):5'- TTAGACAGAGCCTCAAGGAGC -3'
Posted On2013-04-24