Incidental Mutation 'R0368:Slc35b2'
ID30346
Institutional Source Beutler Lab
Gene Symbol Slc35b2
Ensembl Gene ENSMUSG00000037089
Gene Namesolute carrier family 35, member B2
SynonymsPAPST1, 1110003M08Rik
MMRRC Submission 038574-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R0368 (G1)
Quality Score174
Status Not validated
Chromosome17
Chromosomal Location45563874-45567671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45566463 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 172 (V172A)
Ref Sequence ENSEMBL: ENSMUSP00000153367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024739] [ENSMUST00000024742] [ENSMUST00000041353] [ENSMUST00000163966] [ENSMUST00000165127] [ENSMUST00000166469] [ENSMUST00000223987] [ENSMUST00000224905] [ENSMUST00000226086]
Predicted Effect probably benign
Transcript: ENSMUST00000024739
SMART Domains Protein: ENSMUSP00000024739
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
HATPase_c 35 189 3.82e-10 SMART
Pfam:HSP90 191 719 5.4e-246 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000024742
SMART Domains Protein: ENSMUSP00000024742
Gene: ENSMUSG00000023947

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
low complexity region 93 110 N/A INTRINSIC
ANK 122 152 1.14e2 SMART
ANK 157 187 2.15e0 SMART
ANK 190 219 6.81e-3 SMART
ANK 233 262 5.09e-2 SMART
ANK 267 296 1.12e-3 SMART
ANK 300 329 1e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041353
AA Change: V123A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037834
Gene: ENSMUSG00000037089
AA Change: V123A

DomainStartEndE-ValueType
Pfam:UAA 62 363 5.1e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151306
Predicted Effect probably benign
Transcript: ENSMUST00000163966
SMART Domains Protein: ENSMUSP00000131601
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
SCOP:d1byqa_ 9 85 9e-40 SMART
PDB:1UYM|A 14 85 3e-45 PDB
Blast:HATPase_c 35 85 9e-29 BLAST
low complexity region 93 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165127
SMART Domains Protein: ENSMUSP00000126239
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:HSP90 37 161 3.8e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166469
SMART Domains Protein: ENSMUSP00000127338
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
Pfam:HSP90 4 189 1.3e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223987
AA Change: V123A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224559
Predicted Effect probably benign
Transcript: ENSMUST00000224905
AA Change: V172A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225226
Predicted Effect probably benign
Transcript: ENSMUST00000226086
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfotransferases (e.g., SULT4A1; MIM 608359) use an activated form of sulfate, 3-prime-phosphoadenosine 5-prime-phosphosulfate (PAPS), as a common sulfate donor for sulfation of glycoproteins, proteoglycans, and glycolipids in the endoplasmic reticulum and Golgi apparatus. SLC35B2 is located in the microsomal membrane and transports PAPS from the cytosol, where it is synthesized, into the Golgi lumen (Kamiyama et al., 2003 [PubMed 12716889]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A T 19: 9,008,350 K2333* probably null Het
Aox4 C T 1: 58,213,079 L38F probably benign Het
Arhgef15 T C 11: 68,954,693 E111G probably damaging Het
Atp8a2 A T 14: 59,860,212 I789N probably damaging Het
Cdca2 A G 14: 67,700,347 S286P possibly damaging Het
Chrnb1 T A 11: 69,784,757 K457M probably damaging Het
Clec2g A G 6: 128,980,261 I61V possibly damaging Het
Cyb5r3 G A 15: 83,158,792 A233V probably benign Het
Cyp4a10 T A 4: 115,525,377 L278* probably null Het
Dnmt1 T C 9: 20,941,757 E56G probably damaging Het
Fam160b1 A G 19: 57,368,578 T34A possibly damaging Het
Fam166a T A 2: 25,220,673 D164E probably benign Het
Fbln5 A G 12: 101,809,714 probably null Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gabrr3 A G 16: 59,440,596 D289G probably damaging Het
Gpr45 T C 1: 43,033,016 L273P probably damaging Het
Hkdc1 T C 10: 62,411,707 E125G probably null Het
Il25 A G 14: 54,935,174 probably null Het
Itfg1 A T 8: 85,764,407 W298R probably damaging Het
Kank1 A T 19: 25,410,603 K547* probably null Het
Lama5 G A 2: 180,181,230 R2748* probably null Het
Lrp4 C T 2: 91,477,734 T508I probably damaging Het
Map3k10 C T 7: 27,663,360 V434I probably damaging Het
Map3k6 A G 4: 133,252,659 M1265V probably benign Het
Mocs3 C T 2: 168,231,682 P350S probably benign Het
Msh4 T A 3: 153,888,825 Y113F probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nrip1 A G 16: 76,294,016 S218P probably damaging Het
Olfr1281 T C 2: 111,328,787 Y123H probably damaging Het
Olfr1287 T C 2: 111,449,788 I216T probably benign Het
Olig1 C T 16: 91,270,652 S259F probably damaging Het
Osbpl9 A G 4: 109,066,932 V499A probably damaging Het
Pafah2 T C 4: 134,422,491 V371A probably benign Het
Pkp1 T A 1: 135,875,683 M712L probably benign Het
Pkp1 T C 1: 135,886,852 S244G probably benign Het
Ppp1r3a T C 6: 14,718,960 T652A probably benign Het
Rab21 A T 10: 115,298,890 V108E probably damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Scd2 G A 19: 44,301,246 V227I probably benign Het
Sema5b T A 16: 35,628,100 V82E probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Slc13a2 A T 11: 78,404,800 L80* probably null Het
Slc1a5 C T 7: 16,782,178 P93L probably damaging Het
Slfn8 A G 11: 83,017,132 L195P probably damaging Het
Smox G A 2: 131,522,158 S320N probably damaging Het
Sptan1 T C 2: 29,993,915 V589A probably benign Het
Stim2 G A 5: 54,110,140 probably null Het
V1ra8 A G 6: 90,202,962 D49G probably damaging Het
Vmn1r233 A T 17: 20,994,607 V27D possibly damaging Het
Vmn2r98 A T 17: 19,065,827 K196* probably null Het
Wdr77 T C 3: 105,962,066 probably null Het
Other mutations in Slc35b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Slc35b2 APN 17 45564960 missense probably damaging 0.99
IGL02749:Slc35b2 APN 17 45566567 missense probably benign 0.14
IGL02951:Slc35b2 APN 17 45564768 missense probably damaging 1.00
IGL03382:Slc35b2 APN 17 45566645 missense probably damaging 0.98
R0020:Slc35b2 UTSW 17 45566856 missense probably damaging 1.00
R0743:Slc35b2 UTSW 17 45566825 missense probably damaging 1.00
R0884:Slc35b2 UTSW 17 45566825 missense probably damaging 1.00
R2293:Slc35b2 UTSW 17 45567141 missense probably damaging 1.00
R3894:Slc35b2 UTSW 17 45566442 missense probably benign 0.01
R4372:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R4415:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R4416:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R4417:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R5291:Slc35b2 UTSW 17 45566498 missense probably damaging 1.00
R5314:Slc35b2 UTSW 17 45566498 missense probably damaging 1.00
R5929:Slc35b2 UTSW 17 45566661 missense probably benign 0.35
R6178:Slc35b2 UTSW 17 45566376 missense probably benign 0.10
R7217:Slc35b2 UTSW 17 45565029 missense probably benign 0.19
R7561:Slc35b2 UTSW 17 45566801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTATCTGACTTGGGGCATACTGC -3'
(R):5'- TCCTGCCAATTTGAGGTGAAGCTG -3'

Sequencing Primer
(F):5'- CAGGAAAGAGTGATGACTGGC -3'
(R):5'- TGCTCACTCCAATGGAGATG -3'
Posted On2013-04-24