Incidental Mutation 'R0368:Fhip2a'
ID 30351
Institutional Source Beutler Lab
Gene Symbol Fhip2a
Ensembl Gene ENSMUSG00000033478
Gene Name FHF complex subunit HOOK interacting protein 2A
Synonyms Fam160b1
MMRRC Submission 038574-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R0368 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 57349355-57378026 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 57357010 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 34 (T34A)
Ref Sequence ENSEMBL: ENSMUSP00000048903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036407]
AlphaFold Q8CDM8
Predicted Effect possibly damaging
Transcript: ENSMUST00000036407
AA Change: T34A

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048903
Gene: ENSMUSG00000033478
AA Change: T34A

DomainStartEndE-ValueType
Pfam:RAI16-like 78 495 1.1e-144 PFAM
low complexity region 713 724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A T 19: 8,985,714 (GRCm39) K2333* probably null Het
Aox4 C T 1: 58,252,238 (GRCm39) L38F probably benign Het
Arhgef15 T C 11: 68,845,519 (GRCm39) E111G probably damaging Het
Atp8a2 A T 14: 60,097,661 (GRCm39) I789N probably damaging Het
Cdca2 A G 14: 67,937,796 (GRCm39) S286P possibly damaging Het
Chrnb1 T A 11: 69,675,583 (GRCm39) K457M probably damaging Het
Cimip2a T A 2: 25,110,685 (GRCm39) D164E probably benign Het
Clec2g A G 6: 128,957,224 (GRCm39) I61V possibly damaging Het
Cyb5r3 G A 15: 83,042,993 (GRCm39) A233V probably benign Het
Cyp4a10 T A 4: 115,382,574 (GRCm39) L278* probably null Het
Dnmt1 T C 9: 20,853,053 (GRCm39) E56G probably damaging Het
Fbln5 A G 12: 101,775,973 (GRCm39) probably null Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gabrr3 A G 16: 59,260,959 (GRCm39) D289G probably damaging Het
Gpr45 T C 1: 43,072,176 (GRCm39) L273P probably damaging Het
Hkdc1 T C 10: 62,247,486 (GRCm39) E125G probably null Het
Il25 A G 14: 55,172,631 (GRCm39) probably null Het
Itfg1 A T 8: 86,491,036 (GRCm39) W298R probably damaging Het
Kank1 A T 19: 25,387,967 (GRCm39) K547* probably null Het
Lama5 G A 2: 179,823,023 (GRCm39) R2748* probably null Het
Lrp4 C T 2: 91,308,079 (GRCm39) T508I probably damaging Het
Map3k10 C T 7: 27,362,785 (GRCm39) V434I probably damaging Het
Map3k6 A G 4: 132,979,970 (GRCm39) M1265V probably benign Het
Mocs3 C T 2: 168,073,602 (GRCm39) P350S probably benign Het
Msh4 T A 3: 153,594,462 (GRCm39) Y113F probably damaging Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Nrip1 A G 16: 76,090,904 (GRCm39) S218P probably damaging Het
Olig1 C T 16: 91,067,540 (GRCm39) S259F probably damaging Het
Or4k37 T C 2: 111,159,132 (GRCm39) Y123H probably damaging Het
Or4k41 T C 2: 111,280,133 (GRCm39) I216T probably benign Het
Osbpl9 A G 4: 108,924,129 (GRCm39) V499A probably damaging Het
Pafah2 T C 4: 134,149,802 (GRCm39) V371A probably benign Het
Pkp1 T A 1: 135,803,421 (GRCm39) M712L probably benign Het
Pkp1 T C 1: 135,814,590 (GRCm39) S244G probably benign Het
Ppp1r3a T C 6: 14,718,959 (GRCm39) T652A probably benign Het
Rab21 A T 10: 115,134,795 (GRCm39) V108E probably damaging Het
Rab5b C T 10: 128,518,772 (GRCm39) R120Q probably benign Het
Scd2 G A 19: 44,289,685 (GRCm39) V227I probably benign Het
Sema5b T A 16: 35,448,470 (GRCm39) V82E probably damaging Het
Sema6a G A 18: 47,423,112 (GRCm39) probably null Het
Slc13a2 A T 11: 78,295,626 (GRCm39) L80* probably null Het
Slc1a5 C T 7: 16,516,103 (GRCm39) P93L probably damaging Het
Slc35b2 T C 17: 45,877,389 (GRCm39) V172A probably benign Het
Slfn8 A G 11: 82,907,958 (GRCm39) L195P probably damaging Het
Smox G A 2: 131,364,078 (GRCm39) S320N probably damaging Het
Sptan1 T C 2: 29,883,927 (GRCm39) V589A probably benign Het
Stim2 G A 5: 54,267,482 (GRCm39) probably null Het
V1ra8 A G 6: 90,179,944 (GRCm39) D49G probably damaging Het
Vmn1r233 A T 17: 21,214,869 (GRCm39) V27D possibly damaging Het
Vmn2r98 A T 17: 19,286,089 (GRCm39) K196* probably null Het
Wdr77 T C 3: 105,869,382 (GRCm39) probably null Het
Other mutations in Fhip2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Fhip2a APN 19 57,369,777 (GRCm39) missense probably benign 0.00
IGL02642:Fhip2a APN 19 57,373,782 (GRCm39) missense possibly damaging 0.55
IGL03152:Fhip2a APN 19 57,367,264 (GRCm39) missense probably damaging 0.99
fredericksburg UTSW 19 57,372,555 (GRCm39) nonsense probably null
williamsburg UTSW 19 57,372,697 (GRCm39) critical splice donor site probably null
R0001:Fhip2a UTSW 19 57,370,188 (GRCm39) missense probably benign 0.01
R0123:Fhip2a UTSW 19 57,369,839 (GRCm39) missense probably benign 0.00
R0446:Fhip2a UTSW 19 57,369,839 (GRCm39) missense probably benign 0.00
R0508:Fhip2a UTSW 19 57,367,174 (GRCm39) missense probably benign 0.04
R0926:Fhip2a UTSW 19 57,369,522 (GRCm39) missense probably damaging 1.00
R1122:Fhip2a UTSW 19 57,370,733 (GRCm39) missense probably benign 0.00
R1344:Fhip2a UTSW 19 57,359,594 (GRCm39) missense possibly damaging 0.72
R1398:Fhip2a UTSW 19 57,361,358 (GRCm39) splice site probably benign
R1418:Fhip2a UTSW 19 57,359,594 (GRCm39) missense possibly damaging 0.72
R1506:Fhip2a UTSW 19 57,357,007 (GRCm39) missense probably benign 0.30
R1530:Fhip2a UTSW 19 57,374,737 (GRCm39) missense probably damaging 0.99
R1695:Fhip2a UTSW 19 57,367,603 (GRCm39) missense probably damaging 1.00
R1868:Fhip2a UTSW 19 57,374,737 (GRCm39) missense possibly damaging 0.75
R1974:Fhip2a UTSW 19 57,373,809 (GRCm39) missense probably damaging 0.99
R2004:Fhip2a UTSW 19 57,370,324 (GRCm39) missense probably benign
R2893:Fhip2a UTSW 19 57,372,601 (GRCm39) missense probably benign 0.01
R3011:Fhip2a UTSW 19 57,373,720 (GRCm39) missense probably damaging 1.00
R3963:Fhip2a UTSW 19 57,361,442 (GRCm39) missense possibly damaging 0.77
R4416:Fhip2a UTSW 19 57,373,829 (GRCm39) splice site probably null
R4613:Fhip2a UTSW 19 57,359,619 (GRCm39) missense probably damaging 0.99
R4735:Fhip2a UTSW 19 57,359,661 (GRCm39) missense probably damaging 1.00
R4893:Fhip2a UTSW 19 57,370,188 (GRCm39) missense probably benign 0.01
R4937:Fhip2a UTSW 19 57,367,069 (GRCm39) missense probably benign
R5049:Fhip2a UTSW 19 57,374,737 (GRCm39) missense possibly damaging 0.75
R5050:Fhip2a UTSW 19 57,371,602 (GRCm39) missense probably damaging 1.00
R5080:Fhip2a UTSW 19 57,361,713 (GRCm39) missense probably damaging 1.00
R5176:Fhip2a UTSW 19 57,359,613 (GRCm39) missense probably damaging 0.98
R5317:Fhip2a UTSW 19 57,370,141 (GRCm39) splice site probably null
R5347:Fhip2a UTSW 19 57,367,051 (GRCm39) missense probably benign
R5497:Fhip2a UTSW 19 57,369,583 (GRCm39) splice site probably null
R5969:Fhip2a UTSW 19 57,372,555 (GRCm39) nonsense probably null
R6418:Fhip2a UTSW 19 57,370,166 (GRCm39) missense probably benign 0.18
R6426:Fhip2a UTSW 19 57,371,610 (GRCm39) missense probably damaging 1.00
R6765:Fhip2a UTSW 19 57,367,177 (GRCm39) missense probably benign
R7472:Fhip2a UTSW 19 57,357,017 (GRCm39) missense probably damaging 1.00
R7583:Fhip2a UTSW 19 57,367,034 (GRCm39) missense probably benign 0.01
R7672:Fhip2a UTSW 19 57,373,750 (GRCm39) missense possibly damaging 0.95
R8159:Fhip2a UTSW 19 57,372,697 (GRCm39) critical splice donor site probably null
R8510:Fhip2a UTSW 19 57,370,752 (GRCm39) missense probably benign 0.16
R9060:Fhip2a UTSW 19 57,361,450 (GRCm39) missense probably damaging 0.99
R9214:Fhip2a UTSW 19 57,373,756 (GRCm39) missense probably damaging 0.99
R9233:Fhip2a UTSW 19 57,369,098 (GRCm39) missense probably damaging 1.00
R9689:Fhip2a UTSW 19 57,369,710 (GRCm39) missense probably benign 0.01
X0023:Fhip2a UTSW 19 57,372,579 (GRCm39) nonsense probably null
X0062:Fhip2a UTSW 19 57,373,689 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATTGCCAGCGACTCTTCACC -3'
(R):5'- TGTGTGCGACTGACTACTCCACTC -3'

Sequencing Primer
(F):5'- TACATCAGTCACAGAATGACGG -3'
(R):5'- ctccactcccccatgcc -3'
Posted On 2013-04-24