Incidental Mutation 'R0369:Adamts13'
ID30355
Institutional Source Beutler Lab
Gene Symbol Adamts13
Ensembl Gene ENSMUSG00000014852
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13
SynonymsvWF-CP mRNA for von Willebrand factor-cleaving, LOC279028
MMRRC Submission 038575-MU
Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R0369 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26973416-27009628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 27005186 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1096 (D1096E)
Ref Sequence ENSEMBL: ENSMUSP00000099955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102891] [ENSMUST00000114004] [ENSMUST00000114005] [ENSMUST00000114006] [ENSMUST00000114007]
Predicted Effect probably benign
Transcript: ENSMUST00000102891
AA Change: D1096E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000099955
Gene: ENSMUSG00000014852
AA Change: D1096E

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Reprolysin_4 84 287 8.5e-11 PFAM
Pfam:Reprolysin 96 291 4.9e-14 PFAM
Pfam:Reprolysin_3 106 237 5.6e-11 PFAM
TSP1 392 444 3.29e-14 SMART
TSP1 693 748 7.01e0 SMART
TSP1 750 810 3.34e-6 SMART
TSP1 904 959 5.85e0 SMART
TSP1 961 1019 2.69e0 SMART
Blast:TSP1 1022 1079 4e-26 BLAST
TSP1 1081 1137 4.58e-4 SMART
Blast:CUB 1196 1293 2e-39 BLAST
Blast:CUB 1303 1412 3e-63 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114004
SMART Domains Protein: ENSMUSP00000109637
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Cg6151-P 33 106 7.88e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114005
SMART Domains Protein: ENSMUSP00000109638
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Cg6151-P 33 114 5.53e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114006
SMART Domains Protein: ENSMUSP00000109639
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Cg6151-P 33 142 2.87e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114007
SMART Domains Protein: ENSMUSP00000109640
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Cg6151-P 33 142 2.87e-61 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133126
Predicted Effect probably benign
Transcript: ENSMUST00000133807
SMART Domains Protein: ENSMUSP00000122562
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
Cg6151-P 53 118 8.02e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147216
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. In certain mouse strains (C57BL/6, for example) an intracisternal A-type particle (IAP) retrotransposon sequence is located in the intron 23 that causes an alternate splicing event resulting in a shorter transcript variants encoding shorter isoforms. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme that cleaves von Willebrand factor (VWF) in circulating blood. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik G A 9: 114,300,009 noncoding transcript Het
Aadacl2 T A 3: 60,024,722 Y219* probably null Het
Adamts16 T G 13: 70,779,552 K523Q possibly damaging Het
Adcy2 A G 13: 68,671,900 F740S probably benign Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Ccdc97 T C 7: 25,714,408 T283A probably damaging Het
Cmpk2 G T 12: 26,477,151 E380* probably null Het
Csmd3 A G 15: 47,970,147 I911T probably damaging Het
Cyp2c39 T C 19: 39,513,635 L156P probably damaging Het
D7Ertd443e T C 7: 134,298,137 I499V possibly damaging Het
Dhx58 A C 11: 100,701,548 probably null Het
Dip2a C T 10: 76,298,787 G390S probably damaging Het
Dusp10 A G 1: 184,069,056 D340G probably damaging Het
Epha1 A T 6: 42,365,473 C314S probably damaging Het
Exph5 A T 9: 53,373,302 H561L probably benign Het
Fbxw26 A G 9: 109,723,712 probably null Het
Foxc1 A C 13: 31,807,512 N102T probably damaging Het
Fsip2 T C 2: 82,984,564 I3547T probably benign Het
Gm5464 G T 14: 66,869,325 probably benign Het
Gnptab C T 10: 88,433,594 R720C possibly damaging Het
Greb1l T C 18: 10,469,375 V130A possibly damaging Het
Hmg20a A T 9: 56,487,650 D216V probably damaging Het
Hnrnpul2 C A 19: 8,824,413 D328E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ift172 T C 5: 31,253,641 Y1691C probably damaging Het
Kremen2 T C 17: 23,742,810 D241G probably benign Het
Meis2 T C 2: 116,063,416 D5G possibly damaging Het
Mrps5 G A 2: 127,591,829 R46K probably benign Het
Myh14 C T 7: 44,660,950 V170M probably damaging Het
Nexn T C 3: 152,248,257 N123D probably benign Het
Olfr1423 A T 19: 12,036,401 S114T probably benign Het
Olfr606 T A 7: 103,452,216 I293N probably damaging Het
Olfr742 T A 14: 50,515,825 M207K probably benign Het
Pacs1 C T 19: 5,141,698 V704M probably damaging Het
Papolg A G 11: 23,872,425 probably null Het
Pdlim3 T C 8: 45,917,506 V281A probably benign Het
Plpp4 T G 7: 129,323,466 F142V probably damaging Het
Prb1 G A 6: 132,207,657 Q338* probably null Het
Psg26 G T 7: 18,482,556 Y119* probably null Het
Ptger4 A G 15: 5,243,010 C68R probably benign Het
Ptpre T A 7: 135,670,715 I399N probably damaging Het
Ripply2 A G 9: 87,016,319 Y72C probably damaging Het
Rp1l1 T A 14: 64,029,388 S808T possibly damaging Het
Scn5a G A 9: 119,533,772 T594I probably damaging Het
Sf3b1 T C 1: 54,998,108 D883G probably benign Het
Skint5 A T 4: 113,512,023 probably null Het
Terf1 A G 1: 15,818,983 H212R probably damaging Het
Tmco5 T G 2: 116,880,788 probably null Het
Tnfaip3 A T 10: 19,006,912 Y252* probably null Het
Tnrc6a T A 7: 123,170,860 N624K probably damaging Het
Top3a C A 11: 60,742,789 R827L probably damaging Het
Unc79 G A 12: 103,088,772 probably null Het
Usp20 T C 2: 31,011,104 S422P probably benign Het
Utrn T C 10: 12,634,022 E2402G probably benign Het
Wdr3 G A 3: 100,156,418 Q181* probably null Het
Zfp536 T C 7: 37,567,948 E681G probably damaging Het
Zfp91 C T 19: 12,770,074 V562I possibly damaging Het
Zfp942 A T 17: 21,929,036 I204N probably benign Het
Other mutations in Adamts13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Adamts13 APN 2 27005361 missense probably benign 0.04
IGL00465:Adamts13 APN 2 26973555 missense probably benign 0.32
IGL01114:Adamts13 APN 2 27005190 missense probably benign 0.41
IGL01138:Adamts13 APN 2 26983042 missense probably damaging 1.00
IGL01154:Adamts13 APN 2 27006194 missense probably benign
IGL01860:Adamts13 APN 2 26978011 missense probably damaging 0.99
IGL01924:Adamts13 APN 2 26996583 missense possibly damaging 0.80
IGL01991:Adamts13 APN 2 26990598 missense probably damaging 0.97
IGL02215:Adamts13 APN 2 26985483 missense probably damaging 1.00
IGL02415:Adamts13 APN 2 26989283 missense possibly damaging 0.95
IGL02519:Adamts13 APN 2 26978675 missense probably damaging 1.00
IGL02956:Adamts13 APN 2 26983037 missense probably benign 0.18
IGL03209:Adamts13 APN 2 26992961 missense probably benign 0.00
I1329:Adamts13 UTSW 2 26973619 missense possibly damaging 0.52
IGL02837:Adamts13 UTSW 2 26991420 missense probably benign 0.01
IGL03048:Adamts13 UTSW 2 26978699 critical splice donor site probably null
R0041:Adamts13 UTSW 2 26983974 missense probably damaging 1.00
R0217:Adamts13 UTSW 2 26996921 splice site probably benign
R0276:Adamts13 UTSW 2 26975760 missense possibly damaging 0.91
R0309:Adamts13 UTSW 2 26986989 missense probably damaging 0.99
R0348:Adamts13 UTSW 2 26981080 missense probably benign 0.13
R0386:Adamts13 UTSW 2 26986679 splice site probably null
R0553:Adamts13 UTSW 2 26991334 nonsense probably null
R0714:Adamts13 UTSW 2 26986985 splice site probably benign
R0862:Adamts13 UTSW 2 27006324 critical splice donor site probably null
R1320:Adamts13 UTSW 2 26989246 missense probably damaging 0.97
R1458:Adamts13 UTSW 2 26988354 missense probably damaging 1.00
R1473:Adamts13 UTSW 2 26981753 nonsense probably null
R1491:Adamts13 UTSW 2 26978315 missense probably damaging 1.00
R1588:Adamts13 UTSW 2 26975675 missense probably benign 0.01
R1638:Adamts13 UTSW 2 26996583 missense possibly damaging 0.80
R1724:Adamts13 UTSW 2 26991294 missense probably benign 0.00
R1924:Adamts13 UTSW 2 26984141 missense probably damaging 1.00
R2001:Adamts13 UTSW 2 26973990 missense probably benign
R2072:Adamts13 UTSW 2 27005425 missense probably benign 0.10
R2073:Adamts13 UTSW 2 27006314 missense probably damaging 1.00
R2409:Adamts13 UTSW 2 26978362 missense probably benign 0.00
R4362:Adamts13 UTSW 2 27004782 missense probably damaging 1.00
R4363:Adamts13 UTSW 2 27004782 missense probably damaging 1.00
R4422:Adamts13 UTSW 2 27005400 missense probably benign 0.00
R4769:Adamts13 UTSW 2 27008711 nonsense probably null
R4785:Adamts13 UTSW 2 26983042 missense probably damaging 1.00
R4831:Adamts13 UTSW 2 26983130 critical splice donor site probably null
R4832:Adamts13 UTSW 2 26989402 missense probably benign 0.22
R4945:Adamts13 UTSW 2 26986610 missense probably damaging 1.00
R5047:Adamts13 UTSW 2 26996910 missense probably damaging 0.98
R5126:Adamts13 UTSW 2 26996915 critical splice donor site probably null
R5161:Adamts13 UTSW 2 26993008 missense probably benign 0.00
R5394:Adamts13 UTSW 2 26986558 missense probably benign 0.00
R5557:Adamts13 UTSW 2 26973639 missense probably benign 0.05
R5660:Adamts13 UTSW 2 26996749 missense probably benign
R5890:Adamts13 UTSW 2 26986591 missense probably damaging 0.96
R6168:Adamts13 UTSW 2 27004886 missense probably benign 0.37
R6536:Adamts13 UTSW 2 26975750 missense probably damaging 0.99
R6929:Adamts13 UTSW 2 27006263 nonsense probably null
R7207:Adamts13 UTSW 2 26978695 missense probably damaging 1.00
R7211:Adamts13 UTSW 2 26989298 missense probably benign 0.40
R7212:Adamts13 UTSW 2 27006314 missense probably damaging 1.00
R7392:Adamts13 UTSW 2 26989324 missense probably damaging 1.00
R7583:Adamts13 UTSW 2 26973953 missense probably benign
R7604:Adamts13 UTSW 2 27005206 missense probably benign 0.00
R7783:Adamts13 UTSW 2 26990585 missense not run
R7814:Adamts13 UTSW 2 26996549 missense probably benign
X0027:Adamts13 UTSW 2 26985546 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTTGGCACTGCCACACAAATG -3'
(R):5'- AAGCAACAGTAGCAGCAGCCTG -3'

Sequencing Primer
(F):5'- ATTCCGGTGGCACATCAG -3'
(R):5'- CCTGGGTCTGACTGGGAAG -3'
Posted On2013-04-24