Incidental Mutation 'R0369:Fbxw26'
ID30381
Institutional Source Beutler Lab
Gene Symbol Fbxw26
Ensembl Gene ENSMUSG00000059547
Gene NameF-box and WD-40 domain protein 26
SynonymsGm5163
MMRRC Submission 038575-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0369 (G1)
Quality Score186
Status Not validated
Chromosome9
Chromosomal Location109717566-109746089 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 109723712 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000071811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071917]
Predicted Effect probably null
Transcript: ENSMUST00000071917
SMART Domains Protein: ENSMUSP00000071811
Gene: ENSMUSG00000059547

DomainStartEndE-ValueType
FBOX 5 45 2.54e-6 SMART
SCOP:d1tbga_ 128 249 1e-5 SMART
Blast:WD40 137 176 4e-7 BLAST
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik G A 9: 114,300,009 noncoding transcript Het
Aadacl2 T A 3: 60,024,722 Y219* probably null Het
Adamts13 C A 2: 27,005,186 D1096E probably benign Het
Adamts16 T G 13: 70,779,552 K523Q possibly damaging Het
Adcy2 A G 13: 68,671,900 F740S probably benign Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Ccdc97 T C 7: 25,714,408 T283A probably damaging Het
Cmpk2 G T 12: 26,477,151 E380* probably null Het
Csmd3 A G 15: 47,970,147 I911T probably damaging Het
Cyp2c39 T C 19: 39,513,635 L156P probably damaging Het
D7Ertd443e T C 7: 134,298,137 I499V possibly damaging Het
Dhx58 A C 11: 100,701,548 probably null Het
Dip2a C T 10: 76,298,787 G390S probably damaging Het
Dusp10 A G 1: 184,069,056 D340G probably damaging Het
Epha1 A T 6: 42,365,473 C314S probably damaging Het
Exph5 A T 9: 53,373,302 H561L probably benign Het
Foxc1 A C 13: 31,807,512 N102T probably damaging Het
Fsip2 T C 2: 82,984,564 I3547T probably benign Het
Gm5464 G T 14: 66,869,325 probably benign Het
Gnptab C T 10: 88,433,594 R720C possibly damaging Het
Greb1l T C 18: 10,469,375 V130A possibly damaging Het
Hmg20a A T 9: 56,487,650 D216V probably damaging Het
Hnrnpul2 C A 19: 8,824,413 D328E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ift172 T C 5: 31,253,641 Y1691C probably damaging Het
Kremen2 T C 17: 23,742,810 D241G probably benign Het
Meis2 T C 2: 116,063,416 D5G possibly damaging Het
Mrps5 G A 2: 127,591,829 R46K probably benign Het
Myh14 C T 7: 44,660,950 V170M probably damaging Het
Nexn T C 3: 152,248,257 N123D probably benign Het
Olfr1423 A T 19: 12,036,401 S114T probably benign Het
Olfr606 T A 7: 103,452,216 I293N probably damaging Het
Olfr742 T A 14: 50,515,825 M207K probably benign Het
Pacs1 C T 19: 5,141,698 V704M probably damaging Het
Papolg A G 11: 23,872,425 probably null Het
Pdlim3 T C 8: 45,917,506 V281A probably benign Het
Plpp4 T G 7: 129,323,466 F142V probably damaging Het
Prb1 G A 6: 132,207,657 Q338* probably null Het
Psg26 G T 7: 18,482,556 Y119* probably null Het
Ptger4 A G 15: 5,243,010 C68R probably benign Het
Ptpre T A 7: 135,670,715 I399N probably damaging Het
Ripply2 A G 9: 87,016,319 Y72C probably damaging Het
Rp1l1 T A 14: 64,029,388 S808T possibly damaging Het
Scn5a G A 9: 119,533,772 T594I probably damaging Het
Sf3b1 T C 1: 54,998,108 D883G probably benign Het
Skint5 A T 4: 113,512,023 probably null Het
Terf1 A G 1: 15,818,983 H212R probably damaging Het
Tmco5 T G 2: 116,880,788 probably null Het
Tnfaip3 A T 10: 19,006,912 Y252* probably null Het
Tnrc6a T A 7: 123,170,860 N624K probably damaging Het
Top3a C A 11: 60,742,789 R827L probably damaging Het
Unc79 G A 12: 103,088,772 probably null Het
Usp20 T C 2: 31,011,104 S422P probably benign Het
Utrn T C 10: 12,634,022 E2402G probably benign Het
Wdr3 G A 3: 100,156,418 Q181* probably null Het
Zfp536 T C 7: 37,567,948 E681G probably damaging Het
Zfp91 C T 19: 12,770,074 V562I possibly damaging Het
Zfp942 A T 17: 21,929,036 I204N probably benign Het
Other mutations in Fbxw26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Fbxw26 APN 9 109717948 utr 3 prime probably benign
IGL01072:Fbxw26 APN 9 109723837 missense probably damaging 1.00
IGL01151:Fbxw26 APN 9 109721780 missense possibly damaging 0.50
IGL01394:Fbxw26 APN 9 109717989 missense probably benign 0.00
IGL01432:Fbxw26 APN 9 109717975 missense probably benign 0.32
IGL02559:Fbxw26 APN 9 109722164 missense probably benign 0.34
IGL02981:Fbxw26 APN 9 109744794 missense probably benign 0.09
IGL03370:Fbxw26 APN 9 109746019 missense probably damaging 1.00
R0023:Fbxw26 UTSW 9 109718011 missense probably benign 0.01
R0087:Fbxw26 UTSW 9 109724938 missense probably benign
R0446:Fbxw26 UTSW 9 109743720 missense probably benign 0.03
R1844:Fbxw26 UTSW 9 109724878 missense probably benign 0.42
R1891:Fbxw26 UTSW 9 109722164 missense probably benign 0.34
R2042:Fbxw26 UTSW 9 109732704 missense probably damaging 1.00
R3615:Fbxw26 UTSW 9 109743760 nonsense probably null
R3616:Fbxw26 UTSW 9 109743760 nonsense probably null
R4659:Fbxw26 UTSW 9 109744871 missense probably damaging 0.97
R4785:Fbxw26 UTSW 9 109724800 missense possibly damaging 0.50
R4898:Fbxw26 UTSW 9 109717969 missense possibly damaging 0.95
R5791:Fbxw26 UTSW 9 109745153 missense probably damaging 1.00
R5818:Fbxw26 UTSW 9 109732566 missense probably benign
R5921:Fbxw26 UTSW 9 109746018 missense probably damaging 1.00
R5983:Fbxw26 UTSW 9 109717965 missense possibly damaging 0.49
R6145:Fbxw26 UTSW 9 109732623 missense probably benign 0.09
R6209:Fbxw26 UTSW 9 109717965 missense possibly damaging 0.49
R6412:Fbxw26 UTSW 9 109732647 missense probably damaging 0.97
R6842:Fbxw26 UTSW 9 109724920 missense probably damaging 1.00
R7228:Fbxw26 UTSW 9 109724944 missense possibly damaging 0.93
R7451:Fbxw26 UTSW 9 109732623 missense probably benign 0.03
R7467:Fbxw26 UTSW 9 109732697 missense probably benign 0.00
R8397:Fbxw26 UTSW 9 109732647 missense probably damaging 0.99
X0020:Fbxw26 UTSW 9 109732632 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACATCTGTGTGAGTGTATGTAGGCA -3'
(R):5'- GAAAGCGATTTTCAATCACTGGCTGAC -3'

Sequencing Primer
(F):5'- TTCCTGACCCAGTCTCCTAA -3'
(R):5'- ATAACTGAGGTGCCCTTTGAC -3'
Posted On2013-04-24