Incidental Mutation 'R0369:Dip2a'
ID30386
Institutional Source Beutler Lab
Gene Symbol Dip2a
Ensembl Gene ENSMUSG00000020231
Gene Namedisco interacting protein 2 homolog A
SynonymsKiaa0184-hp, 4931420H10Rik, Dip2
MMRRC Submission 038575-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0369 (G1)
Quality Score205
Status Not validated
Chromosome10
Chromosomal Location76259429-76345291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76298787 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 390 (G390S)
Ref Sequence ENSEMBL: ENSMUSP00000125184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036033] [ENSMUST00000105417] [ENSMUST00000160048]
Predicted Effect probably damaging
Transcript: ENSMUST00000036033
AA Change: G429S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043710
Gene: ENSMUSG00000020231
AA Change: G429S

DomainStartEndE-ValueType
DMAP_binding 9 122 2.55e-35 SMART
low complexity region 173 208 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
Pfam:AMP-binding 330 806 4.3e-26 PFAM
Pfam:AMP-binding 982 1456 1.4e-52 PFAM
low complexity region 1487 1498 N/A INTRINSIC
low complexity region 1511 1532 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105417
AA Change: G429S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101057
Gene: ENSMUSG00000020231
AA Change: G429S

DomainStartEndE-ValueType
DMAP_binding 9 122 2.55e-35 SMART
low complexity region 173 208 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
Pfam:AMP-binding 330 806 6.6e-28 PFAM
Pfam:AMP-binding 992 1466 7.3e-65 PFAM
low complexity region 1497 1508 N/A INTRINSIC
low complexity region 1521 1542 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160048
AA Change: G390S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125184
Gene: ENSMUSG00000020231
AA Change: G390S

DomainStartEndE-ValueType
DMAP_binding 9 83 7.94e-23 SMART
low complexity region 134 169 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
Pfam:AMP-binding 291 767 5.3e-26 PFAM
Pfam:AMP-binding 943 1417 1.7e-52 PFAM
low complexity region 1448 1459 N/A INTRINSIC
low complexity region 1472 1493 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162766
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be involved in axon patterning in the central nervous system. This gene is not highly expressed. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik G A 9: 114,300,009 noncoding transcript Het
Aadacl2 T A 3: 60,024,722 Y219* probably null Het
Adamts13 C A 2: 27,005,186 D1096E probably benign Het
Adamts16 T G 13: 70,779,552 K523Q possibly damaging Het
Adcy2 A G 13: 68,671,900 F740S probably benign Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Ccdc97 T C 7: 25,714,408 T283A probably damaging Het
Cmpk2 G T 12: 26,477,151 E380* probably null Het
Csmd3 A G 15: 47,970,147 I911T probably damaging Het
Cyp2c39 T C 19: 39,513,635 L156P probably damaging Het
D7Ertd443e T C 7: 134,298,137 I499V possibly damaging Het
Dhx58 A C 11: 100,701,548 probably null Het
Dusp10 A G 1: 184,069,056 D340G probably damaging Het
Epha1 A T 6: 42,365,473 C314S probably damaging Het
Exph5 A T 9: 53,373,302 H561L probably benign Het
Fbxw26 A G 9: 109,723,712 probably null Het
Foxc1 A C 13: 31,807,512 N102T probably damaging Het
Fsip2 T C 2: 82,984,564 I3547T probably benign Het
Gm5464 G T 14: 66,869,325 probably benign Het
Gnptab C T 10: 88,433,594 R720C possibly damaging Het
Greb1l T C 18: 10,469,375 V130A possibly damaging Het
Hmg20a A T 9: 56,487,650 D216V probably damaging Het
Hnrnpul2 C A 19: 8,824,413 D328E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ift172 T C 5: 31,253,641 Y1691C probably damaging Het
Kremen2 T C 17: 23,742,810 D241G probably benign Het
Meis2 T C 2: 116,063,416 D5G possibly damaging Het
Mrps5 G A 2: 127,591,829 R46K probably benign Het
Myh14 C T 7: 44,660,950 V170M probably damaging Het
Nexn T C 3: 152,248,257 N123D probably benign Het
Olfr1423 A T 19: 12,036,401 S114T probably benign Het
Olfr606 T A 7: 103,452,216 I293N probably damaging Het
Olfr742 T A 14: 50,515,825 M207K probably benign Het
Pacs1 C T 19: 5,141,698 V704M probably damaging Het
Papolg A G 11: 23,872,425 probably null Het
Pdlim3 T C 8: 45,917,506 V281A probably benign Het
Plpp4 T G 7: 129,323,466 F142V probably damaging Het
Prb1 G A 6: 132,207,657 Q338* probably null Het
Psg26 G T 7: 18,482,556 Y119* probably null Het
Ptger4 A G 15: 5,243,010 C68R probably benign Het
Ptpre T A 7: 135,670,715 I399N probably damaging Het
Ripply2 A G 9: 87,016,319 Y72C probably damaging Het
Rp1l1 T A 14: 64,029,388 S808T possibly damaging Het
Scn5a G A 9: 119,533,772 T594I probably damaging Het
Sf3b1 T C 1: 54,998,108 D883G probably benign Het
Skint5 A T 4: 113,512,023 probably null Het
Terf1 A G 1: 15,818,983 H212R probably damaging Het
Tmco5 T G 2: 116,880,788 probably null Het
Tnfaip3 A T 10: 19,006,912 Y252* probably null Het
Tnrc6a T A 7: 123,170,860 N624K probably damaging Het
Top3a C A 11: 60,742,789 R827L probably damaging Het
Unc79 G A 12: 103,088,772 probably null Het
Usp20 T C 2: 31,011,104 S422P probably benign Het
Utrn T C 10: 12,634,022 E2402G probably benign Het
Wdr3 G A 3: 100,156,418 Q181* probably null Het
Zfp536 T C 7: 37,567,948 E681G probably damaging Het
Zfp91 C T 19: 12,770,074 V562I possibly damaging Het
Zfp942 A T 17: 21,929,036 I204N probably benign Het
Other mutations in Dip2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Dip2a APN 10 76313236 missense probably benign
IGL00849:Dip2a APN 10 76292318 missense probably damaging 0.99
IGL01685:Dip2a APN 10 76327749 missense probably damaging 1.00
IGL01825:Dip2a APN 10 76272680 nonsense probably null
IGL02343:Dip2a APN 10 76319478 missense probably benign 0.00
IGL02437:Dip2a APN 10 76298267 missense probably benign 0.09
IGL02981:Dip2a APN 10 76276421 missense possibly damaging 0.84
IGL03122:Dip2a APN 10 76275046 missense probably benign 0.00
IGL03261:Dip2a APN 10 76305148 missense possibly damaging 0.80
R0522:Dip2a UTSW 10 76321531 missense probably benign 0.03
R0962:Dip2a UTSW 10 76292432 unclassified probably benign
R1164:Dip2a UTSW 10 76276397 missense possibly damaging 0.72
R1309:Dip2a UTSW 10 76279776 missense probably damaging 1.00
R1426:Dip2a UTSW 10 76279820 unclassified probably benign
R1636:Dip2a UTSW 10 76321578 missense probably benign 0.01
R1823:Dip2a UTSW 10 76278502 nonsense probably null
R1830:Dip2a UTSW 10 76317963 missense probably damaging 1.00
R1876:Dip2a UTSW 10 76318091 missense probably damaging 1.00
R2284:Dip2a UTSW 10 76313193 missense probably benign 0.01
R2369:Dip2a UTSW 10 76313196 missense probably benign
R4050:Dip2a UTSW 10 76278607 missense probably damaging 1.00
R4089:Dip2a UTSW 10 76278489 splice site probably null
R4231:Dip2a UTSW 10 76319470 missense probably damaging 1.00
R4715:Dip2a UTSW 10 76296406 missense probably benign 0.34
R4752:Dip2a UTSW 10 76276657 missense probably damaging 1.00
R4846:Dip2a UTSW 10 76321493 missense probably damaging 1.00
R4849:Dip2a UTSW 10 76294533 missense probably damaging 1.00
R4892:Dip2a UTSW 10 76280759 missense probably benign 0.02
R4998:Dip2a UTSW 10 76319556 nonsense probably null
R5068:Dip2a UTSW 10 76318043 missense possibly damaging 0.82
R5141:Dip2a UTSW 10 76270453 missense probably damaging 1.00
R5253:Dip2a UTSW 10 76299997 missense probably damaging 1.00
R5304:Dip2a UTSW 10 76294523 missense possibly damaging 0.67
R5324:Dip2a UTSW 10 76296393 missense probably damaging 1.00
R5369:Dip2a UTSW 10 76292360 missense probably damaging 1.00
R6272:Dip2a UTSW 10 76286407 makesense probably null
R6884:Dip2a UTSW 10 76272532 critical splice donor site probably null
R7143:Dip2a UTSW 10 76297791 missense probably damaging 1.00
R7247:Dip2a UTSW 10 76272532 critical splice donor site probably null
R7252:Dip2a UTSW 10 76273202 missense not run
R7327:Dip2a UTSW 10 76272562 missense probably benign 0.41
R7334:Dip2a UTSW 10 76274246 missense possibly damaging 0.91
R7349:Dip2a UTSW 10 76285592 missense probably damaging 1.00
R7360:Dip2a UTSW 10 76278560 missense probably damaging 1.00
R7513:Dip2a UTSW 10 76313235 missense probably benign
Z1088:Dip2a UTSW 10 76285628 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCTTAGACAGAGAAGCATGGAGCAC -3'
(R):5'- AGTAGGTTCCAGACAGGACTCAGTG -3'

Sequencing Primer
(F):5'- ACAAGTATGTCCTCTGCTGTG -3'
(R):5'- GTGCAATAAATTAGTCCACTCTCCAG -3'
Posted On2013-04-24