Incidental Mutation 'R0369:Papolg'
ID30388
Institutional Source Beutler Lab
Gene Symbol Papolg
Ensembl Gene ENSMUSG00000020273
Gene Namepoly(A) polymerase gamma
Synonyms
MMRRC Submission 038575-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R0369 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location23862646-23895253 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 23872425 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020513] [ENSMUST00000102863]
Predicted Effect probably null
Transcript: ENSMUST00000020513
SMART Domains Protein: ENSMUSP00000020513
Gene: ENSMUSG00000020273

DomainStartEndE-ValueType
Pfam:PAP_central 20 363 1.4e-118 PFAM
Pfam:NTP_transf_2 53 174 2.8e-15 PFAM
Pfam:PAP_RNA-bind 365 431 2.4e-22 PFAM
Pfam:PAP_RNA-bind 421 506 1.2e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102863
SMART Domains Protein: ENSMUSP00000099927
Gene: ENSMUSG00000020273

DomainStartEndE-ValueType
Pfam:PAP_central 16 364 1.5e-111 PFAM
Pfam:NTP_transf_2 89 174 9.2e-12 PFAM
Pfam:PAP_RNA-bind 365 429 6.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145013
SMART Domains Protein: ENSMUSP00000115518
Gene: ENSMUSG00000020273

DomainStartEndE-ValueType
SCOP:d1f5aa1 2 29 3e-10 SMART
PDB:4LT6|B 2 38 4e-16 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150711
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(A) polymerase family which catalyzes template-independent extension of the 3' end of a DNA/RNA strand. This enzyme shares 60% identity to the well characterized poly(A) polymerase II (PAPII) at the amino acid level. These two enzymes have similar organization of structural and functional domains. This enzyme is exclusively localized in the nucleus and exhibits both nonspecific and CPSF (cleavage and polyadenylation specificity factor)/AAUAAA-dependent polyadenylation activity. This gene is located on chromosome 2 in contrast to the PAPII gene, which is located on chromosome 14. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik G A 9: 114,300,009 noncoding transcript Het
Aadacl2 T A 3: 60,024,722 Y219* probably null Het
Adamts13 C A 2: 27,005,186 D1096E probably benign Het
Adamts16 T G 13: 70,779,552 K523Q possibly damaging Het
Adcy2 A G 13: 68,671,900 F740S probably benign Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Ccdc97 T C 7: 25,714,408 T283A probably damaging Het
Cmpk2 G T 12: 26,477,151 E380* probably null Het
Csmd3 A G 15: 47,970,147 I911T probably damaging Het
Cyp2c39 T C 19: 39,513,635 L156P probably damaging Het
D7Ertd443e T C 7: 134,298,137 I499V possibly damaging Het
Dhx58 A C 11: 100,701,548 probably null Het
Dip2a C T 10: 76,298,787 G390S probably damaging Het
Dusp10 A G 1: 184,069,056 D340G probably damaging Het
Epha1 A T 6: 42,365,473 C314S probably damaging Het
Exph5 A T 9: 53,373,302 H561L probably benign Het
Fbxw26 A G 9: 109,723,712 probably null Het
Foxc1 A C 13: 31,807,512 N102T probably damaging Het
Fsip2 T C 2: 82,984,564 I3547T probably benign Het
Gm5464 G T 14: 66,869,325 probably benign Het
Gnptab C T 10: 88,433,594 R720C possibly damaging Het
Greb1l T C 18: 10,469,375 V130A possibly damaging Het
Hmg20a A T 9: 56,487,650 D216V probably damaging Het
Hnrnpul2 C A 19: 8,824,413 D328E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ift172 T C 5: 31,253,641 Y1691C probably damaging Het
Kremen2 T C 17: 23,742,810 D241G probably benign Het
Meis2 T C 2: 116,063,416 D5G possibly damaging Het
Mrps5 G A 2: 127,591,829 R46K probably benign Het
Myh14 C T 7: 44,660,950 V170M probably damaging Het
Nexn T C 3: 152,248,257 N123D probably benign Het
Olfr1423 A T 19: 12,036,401 S114T probably benign Het
Olfr606 T A 7: 103,452,216 I293N probably damaging Het
Olfr742 T A 14: 50,515,825 M207K probably benign Het
Pacs1 C T 19: 5,141,698 V704M probably damaging Het
Pdlim3 T C 8: 45,917,506 V281A probably benign Het
Plpp4 T G 7: 129,323,466 F142V probably damaging Het
Prb1 G A 6: 132,207,657 Q338* probably null Het
Psg26 G T 7: 18,482,556 Y119* probably null Het
Ptger4 A G 15: 5,243,010 C68R probably benign Het
Ptpre T A 7: 135,670,715 I399N probably damaging Het
Ripply2 A G 9: 87,016,319 Y72C probably damaging Het
Rp1l1 T A 14: 64,029,388 S808T possibly damaging Het
Scn5a G A 9: 119,533,772 T594I probably damaging Het
Sf3b1 T C 1: 54,998,108 D883G probably benign Het
Skint5 A T 4: 113,512,023 probably null Het
Terf1 A G 1: 15,818,983 H212R probably damaging Het
Tmco5 T G 2: 116,880,788 probably null Het
Tnfaip3 A T 10: 19,006,912 Y252* probably null Het
Tnrc6a T A 7: 123,170,860 N624K probably damaging Het
Top3a C A 11: 60,742,789 R827L probably damaging Het
Unc79 G A 12: 103,088,772 probably null Het
Usp20 T C 2: 31,011,104 S422P probably benign Het
Utrn T C 10: 12,634,022 E2402G probably benign Het
Wdr3 G A 3: 100,156,418 Q181* probably null Het
Zfp536 T C 7: 37,567,948 E681G probably damaging Het
Zfp91 C T 19: 12,770,074 V562I possibly damaging Het
Zfp942 A T 17: 21,929,036 I204N probably benign Het
Other mutations in Papolg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Papolg APN 11 23876377 missense possibly damaging 0.93
IGL01016:Papolg APN 11 23885570 missense possibly damaging 0.58
IGL01394:Papolg APN 11 23867235 missense probably benign
IGL01710:Papolg APN 11 23864026 missense probably damaging 0.99
IGL01786:Papolg APN 11 23874488 missense probably damaging 1.00
IGL02008:Papolg APN 11 23879898 missense probably damaging 1.00
IGL02127:Papolg APN 11 23870870 unclassified probably benign
IGL02329:Papolg APN 11 23891869 missense probably damaging 0.98
IGL02535:Papolg APN 11 23890245 missense probably benign 0.00
IGL02588:Papolg APN 11 23890252 missense probably damaging 1.00
IGL03058:Papolg APN 11 23895029 missense probably benign 0.00
IGL03301:Papolg APN 11 23874503 missense probably benign 0.05
R0124:Papolg UTSW 11 23867535 missense probably benign 0.21
R0454:Papolg UTSW 11 23879868 splice site probably null
R0743:Papolg UTSW 11 23870818 unclassified probably null
R0931:Papolg UTSW 11 23882257 missense probably damaging 0.96
R1856:Papolg UTSW 11 23867379 missense probably benign 0.06
R1940:Papolg UTSW 11 23867279 missense probably benign 0.00
R2239:Papolg UTSW 11 23876378 missense probably damaging 0.99
R3802:Papolg UTSW 11 23876449 missense probably damaging 1.00
R4275:Papolg UTSW 11 23868378 missense probably benign
R4989:Papolg UTSW 11 23873919 splice site probably null
R5074:Papolg UTSW 11 23867331 missense possibly damaging 0.78
R5122:Papolg UTSW 11 23867501 critical splice donor site probably null
R6048:Papolg UTSW 11 23891815 missense probably benign 0.04
R6365:Papolg UTSW 11 23882290 missense probably damaging 1.00
R6577:Papolg UTSW 11 23879857 critical splice donor site probably benign
R7117:Papolg UTSW 11 23895207 start gained probably benign
R7283:Papolg UTSW 11 23867394 missense not run
R7372:Papolg UTSW 11 23866439 missense probably benign 0.16
R7761:Papolg UTSW 11 23891884 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGAACTCAATGACATAATCCCCGATGC -3'
(R):5'- CAGTAGAAATCTTGAGTGGTCAGGGC -3'

Sequencing Primer
(F):5'- CGATGCCCCATCATGTATGT -3'
(R):5'- GCTAGTCTAGCATCAGTGATAGTTG -3'
Posted On2013-04-24