Incidental Mutation 'R0369:Pacs1'
ID 30405
Institutional Source Beutler Lab
Gene Symbol Pacs1
Ensembl Gene ENSMUSG00000024855
Gene Name phosphofurin acidic cluster sorting protein 1
Synonyms
MMRRC Submission 038575-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0369 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 5133688-5273119 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 5141698 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 704 (V704M)
Ref Sequence ENSEMBL: ENSMUSP00000025786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025786]
AlphaFold Q8K212
Predicted Effect probably damaging
Transcript: ENSMUST00000025786
AA Change: V704M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025786
Gene: ENSMUSG00000024855
AA Change: V704M

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 27 46 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Pfam:Pacs-1 546 958 2e-193 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a putative role in the localization of trans-Golgi network (TGN) membrane proteins. Mouse and rat homologs have been identified and studies of the homologous rat protein indicate a role in directing TGN localization of furin by binding to the protease's phosphorylated cytosolic domain. In addition, the human protein plays a role in HIV-1 Nef-mediated downregulation of cell surface MHC-I molecules to the TGN, thereby enabling HIV-1 to escape immune surveillance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik G A 9: 114,300,009 noncoding transcript Het
Aadacl2 T A 3: 60,024,722 Y219* probably null Het
Adamts13 C A 2: 27,005,186 D1096E probably benign Het
Adamts16 T G 13: 70,779,552 K523Q possibly damaging Het
Adcy2 A G 13: 68,671,900 F740S probably benign Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Ccdc97 T C 7: 25,714,408 T283A probably damaging Het
Cmpk2 G T 12: 26,477,151 E380* probably null Het
Csmd3 A G 15: 47,970,147 I911T probably damaging Het
Cyp2c39 T C 19: 39,513,635 L156P probably damaging Het
D7Ertd443e T C 7: 134,298,137 I499V possibly damaging Het
Dhx58 A C 11: 100,701,548 probably null Het
Dip2a C T 10: 76,298,787 G390S probably damaging Het
Dusp10 A G 1: 184,069,056 D340G probably damaging Het
Epha1 A T 6: 42,365,473 C314S probably damaging Het
Exph5 A T 9: 53,373,302 H561L probably benign Het
Fbxw26 A G 9: 109,723,712 probably null Het
Foxc1 A C 13: 31,807,512 N102T probably damaging Het
Fsip2 T C 2: 82,984,564 I3547T probably benign Het
Gm5464 G T 14: 66,869,325 probably benign Het
Gnptab C T 10: 88,433,594 R720C possibly damaging Het
Greb1l T C 18: 10,469,375 V130A possibly damaging Het
Hmg20a A T 9: 56,487,650 D216V probably damaging Het
Hnrnpul2 C A 19: 8,824,413 D328E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ift172 T C 5: 31,253,641 Y1691C probably damaging Het
Kremen2 T C 17: 23,742,810 D241G probably benign Het
Meis2 T C 2: 116,063,416 D5G possibly damaging Het
Mrps5 G A 2: 127,591,829 R46K probably benign Het
Myh14 C T 7: 44,660,950 V170M probably damaging Het
Nexn T C 3: 152,248,257 N123D probably benign Het
Olfr1423 A T 19: 12,036,401 S114T probably benign Het
Olfr606 T A 7: 103,452,216 I293N probably damaging Het
Olfr742 T A 14: 50,515,825 M207K probably benign Het
Papolg A G 11: 23,872,425 probably null Het
Pdlim3 T C 8: 45,917,506 V281A probably benign Het
Plpp4 T G 7: 129,323,466 F142V probably damaging Het
Prb1 G A 6: 132,207,657 Q338* probably null Het
Psg26 G T 7: 18,482,556 Y119* probably null Het
Ptger4 A G 15: 5,243,010 C68R probably benign Het
Ptpre T A 7: 135,670,715 I399N probably damaging Het
Ripply2 A G 9: 87,016,319 Y72C probably damaging Het
Rp1l1 T A 14: 64,029,388 S808T possibly damaging Het
Scn5a G A 9: 119,533,772 T594I probably damaging Het
Sf3b1 T C 1: 54,998,108 D883G probably benign Het
Skint5 A T 4: 113,512,023 probably null Het
Terf1 A G 1: 15,818,983 H212R probably damaging Het
Tmco5 T G 2: 116,880,788 probably null Het
Tnfaip3 A T 10: 19,006,912 Y252* probably null Het
Tnrc6a T A 7: 123,170,860 N624K probably damaging Het
Top3a C A 11: 60,742,789 R827L probably damaging Het
Unc79 G A 12: 103,088,772 probably null Het
Usp20 T C 2: 31,011,104 S422P probably benign Het
Utrn T C 10: 12,634,022 E2402G probably benign Het
Wdr3 G A 3: 100,156,418 Q181* probably null Het
Zfp536 T C 7: 37,567,948 E681G probably damaging Het
Zfp91 C T 19: 12,770,074 V562I possibly damaging Het
Zfp942 A T 17: 21,929,036 I204N probably benign Het
Other mutations in Pacs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Pacs1 APN 19 5153698 missense probably damaging 0.98
IGL01335:Pacs1 APN 19 5142632 missense probably damaging 1.00
IGL01717:Pacs1 APN 19 5167972 missense probably damaging 1.00
IGL02453:Pacs1 APN 19 5135005 missense probably damaging 1.00
IGL02887:Pacs1 APN 19 5135110 splice site probably benign
Batavian UTSW 19 5156413 missense possibly damaging 0.71
chicory UTSW 19 5139297 missense probably benign 0.33
endive UTSW 19 5272583 nonsense probably null
Escarole UTSW 19 5156356 critical splice donor site probably null
frisee UTSW 19 5136791 missense probably damaging 1.00
R0240:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R0240:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R0316:Pacs1 UTSW 19 5135121 splice site silent
R0443:Pacs1 UTSW 19 5272583 nonsense probably null
R0973:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R0973:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R0974:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R1202:Pacs1 UTSW 19 5135237 missense probably damaging 1.00
R1672:Pacs1 UTSW 19 5152309 missense probably benign 0.00
R1689:Pacs1 UTSW 19 5272615 unclassified probably benign
R1842:Pacs1 UTSW 19 5155884 missense probably damaging 0.96
R1847:Pacs1 UTSW 19 5153714 missense probably damaging 0.99
R3884:Pacs1 UTSW 19 5155759 missense probably damaging 0.99
R4577:Pacs1 UTSW 19 5143833 nonsense probably null
R4630:Pacs1 UTSW 19 5156356 critical splice donor site probably null
R5029:Pacs1 UTSW 19 5142271 missense probably benign 0.03
R5198:Pacs1 UTSW 19 5139297 missense probably benign 0.33
R5223:Pacs1 UTSW 19 5145141 missense probably benign 0.00
R5464:Pacs1 UTSW 19 5147207 missense probably benign
R5695:Pacs1 UTSW 19 5136791 missense probably damaging 1.00
R6128:Pacs1 UTSW 19 5152372 splice site probably null
R6335:Pacs1 UTSW 19 5159977 missense probably damaging 1.00
R6802:Pacs1 UTSW 19 5152784 missense probably damaging 0.99
R6831:Pacs1 UTSW 19 5160795 missense probably damaging 1.00
R7071:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R7200:Pacs1 UTSW 19 5156413 missense possibly damaging 0.71
R7248:Pacs1 UTSW 19 5138975 missense probably damaging 1.00
R7576:Pacs1 UTSW 19 5145120 missense probably benign 0.09
R7682:Pacs1 UTSW 19 5152699 missense probably damaging 0.99
R7715:Pacs1 UTSW 19 5141681 missense probably benign 0.01
R7738:Pacs1 UTSW 19 5152350 missense probably benign 0.11
R8339:Pacs1 UTSW 19 5142623 missense probably damaging 1.00
R8930:Pacs1 UTSW 19 5135002 missense probably damaging 1.00
R8932:Pacs1 UTSW 19 5135002 missense probably damaging 1.00
R9043:Pacs1 UTSW 19 5138936 missense probably benign 0.23
R9211:Pacs1 UTSW 19 5139029 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCAGTCACCAGTGAGGACAACAAC -3'
(R):5'- GCATCAGAGTCCAGCTCAGGAAAG -3'

Sequencing Primer
(F):5'- TTTAGGGCCTCTCCAACAGG -3'
(R):5'- AAGAGAGGACTGTGCTTTGG -3'
Posted On 2013-04-24