Incidental Mutation 'R0370:Pkn3'
ID30412
Institutional Source Beutler Lab
Gene Symbol Pkn3
Ensembl Gene ENSMUSG00000026785
Gene Nameprotein kinase N3
Synonyms
MMRRC Submission 038576-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0370 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location30077684-30091022 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30087172 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 641 (H641Q)
Ref Sequence ENSEMBL: ENSMUSP00000041025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045246] [ENSMUST00000081838] [ENSMUST00000102865]
Predicted Effect probably damaging
Transcript: ENSMUST00000045246
AA Change: H641Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041025
Gene: ENSMUSG00000026785
AA Change: H641Q

DomainStartEndE-ValueType
Hr1 15 78 3.45e-17 SMART
Hr1 98 166 6.19e-19 SMART
Hr1 171 239 3.32e-19 SMART
low complexity region 528 537 N/A INTRINSIC
S_TKc 548 807 2.52e-93 SMART
S_TK_X 808 872 9.58e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081838
SMART Domains Protein: ENSMUSP00000080521
Gene: ENSMUSG00000015335

DomainStartEndE-ValueType
transmembrane domain 58 80 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
Pfam:zf-DHHC 106 232 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102865
SMART Domains Protein: ENSMUSP00000099929
Gene: ENSMUSG00000015335

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:zf-DHHC 58 218 1.1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156197
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable, fertile and healthy. Mice with conditional loss of this gene and Pten in hematopoietic cells show a delay in leukemia development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l1 T C 8: 123,501,554 S666P probably damaging Het
B3gntl1 A T 11: 121,624,154 W263R probably damaging Het
Carmil3 A G 14: 55,495,442 N270S possibly damaging Het
Ctdp1 T C 18: 80,449,354 E642G probably damaging Het
Cyp2b9 A T 7: 26,210,106 K433M probably damaging Het
Dcc A G 18: 71,587,985 V435A possibly damaging Het
Defa26 A T 8: 21,618,859 M87L probably benign Het
Dnah11 T A 12: 117,995,227 I2974L probably benign Het
Dnah3 T C 7: 120,086,720 D131G possibly damaging Het
Dock6 A T 9: 21,814,565 S1447R probably benign Het
Dtl G T 1: 191,575,350 N17K probably benign Het
Grid2 A G 6: 64,345,734 I573V possibly damaging Het
Hoxa9 T C 6: 52,225,704 E134G possibly damaging Het
Kcnn3 A T 3: 89,667,092 N637I probably damaging Het
Ktn1 T C 14: 47,664,075 F97L probably benign Het
Lmbrd2 T C 15: 9,165,852 I271T probably damaging Het
Lrp6 A C 6: 134,479,766 I845S probably damaging Het
Med13l T A 5: 118,741,826 N994K probably benign Het
Mrrf A T 2: 36,177,113 probably null Het
Mtmr1 G A X: 71,388,231 V125I probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Olfr1047 A T 2: 86,228,713 V86D probably damaging Het
Olfr309 T A 7: 86,306,849 N88I probably benign Het
Olfr639 T G 7: 104,012,059 L214F probably damaging Het
Paxip1 C A 5: 27,760,086 V659F probably damaging Het
Pclo T C 5: 14,521,090 V163A probably damaging Het
Plekhg6 G A 6: 125,370,660 R444C probably damaging Het
Rfx2 T C 17: 56,799,308 E175G probably benign Het
Samd9l A C 6: 3,377,264 probably benign Het
Sec14l5 A T 16: 5,180,706 T537S probably damaging Het
Serpinb9d A G 13: 33,195,966 E96G probably damaging Het
Setd4 T C 16: 93,591,118 E160G probably damaging Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Slc16a4 A G 3: 107,301,097 I308V possibly damaging Het
Slco2b1 T A 7: 99,690,437 N100Y probably damaging Het
Sptbn1 A T 11: 30,121,545 S1475R probably benign Het
Tecta T C 9: 42,366,804 D1136G probably benign Het
Tmem94 G C 11: 115,788,717 R273S probably damaging Het
Tns3 A G 11: 8,445,730 S1225P possibly damaging Het
Ugt2b36 A G 5: 87,091,975 Y184H probably benign Het
Vmn2r59 A T 7: 42,012,726 M555K probably benign Het
Other mutations in Pkn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Pkn3 APN 2 30081104 missense probably damaging 0.97
IGL00781:Pkn3 APN 2 30083390 unclassified probably benign
IGL00815:Pkn3 APN 2 30081200 missense possibly damaging 0.88
IGL01576:Pkn3 APN 2 30087042 missense probably damaging 1.00
IGL01897:Pkn3 APN 2 30082812 unclassified probably benign
IGL02513:Pkn3 APN 2 30083137 missense probably damaging 0.98
IGL02552:Pkn3 APN 2 30080867 missense probably damaging 1.00
IGL02622:Pkn3 APN 2 30083146 missense probably benign 0.28
IGL02689:Pkn3 APN 2 30080846 missense probably damaging 1.00
IGL02996:Pkn3 APN 2 30080615 missense probably benign 0.39
IGL03106:Pkn3 APN 2 30085245 missense probably damaging 0.96
Enflamme UTSW 2 30083037 unclassified probably benign
Wrath UTSW 2 30088584 critical splice donor site probably null
PIT4151001:Pkn3 UTSW 2 30090527 missense probably damaging 1.00
R0279:Pkn3 UTSW 2 30083297 missense probably benign 0.16
R0491:Pkn3 UTSW 2 30089877 missense probably damaging 1.00
R0600:Pkn3 UTSW 2 30081134 missense probably benign 0.06
R1418:Pkn3 UTSW 2 30083047 missense probably damaging 1.00
R1510:Pkn3 UTSW 2 30079764 critical splice donor site probably null
R1535:Pkn3 UTSW 2 30087053 missense probably benign
R1540:Pkn3 UTSW 2 30084691 missense probably damaging 1.00
R1808:Pkn3 UTSW 2 30079651 missense probably damaging 1.00
R1884:Pkn3 UTSW 2 30082828 missense probably damaging 1.00
R1995:Pkn3 UTSW 2 30089977 missense probably damaging 1.00
R3745:Pkn3 UTSW 2 30090341 missense probably damaging 1.00
R4119:Pkn3 UTSW 2 30083037 unclassified probably benign
R4258:Pkn3 UTSW 2 30088560 missense probably damaging 0.99
R4665:Pkn3 UTSW 2 30085457 unclassified probably benign
R4772:Pkn3 UTSW 2 30084680 splice site probably null
R4808:Pkn3 UTSW 2 30090081 missense probably damaging 1.00
R5038:Pkn3 UTSW 2 30085281 critical splice donor site probably null
R5388:Pkn3 UTSW 2 30081074 missense probably damaging 0.99
R5488:Pkn3 UTSW 2 30088584 critical splice donor site probably null
R5611:Pkn3 UTSW 2 30079661 missense probably damaging 1.00
R6001:Pkn3 UTSW 2 30088584 critical splice donor site probably null
R6277:Pkn3 UTSW 2 30082945 missense possibly damaging 0.93
R6562:Pkn3 UTSW 2 30080687 critical splice donor site probably null
R6724:Pkn3 UTSW 2 30090550 missense possibly damaging 0.94
R7061:Pkn3 UTSW 2 30083536 splice site probably null
R7128:Pkn3 UTSW 2 30083315 missense probably damaging 1.00
R7249:Pkn3 UTSW 2 30084761 missense probably benign 0.00
R7475:Pkn3 UTSW 2 30087110 missense probably benign 0.01
R7746:Pkn3 UTSW 2 30090584 missense probably benign 0.00
R7747:Pkn3 UTSW 2 30090584 missense probably benign 0.00
R7783:Pkn3 UTSW 2 30079622 missense probably damaging 1.00
R8401:Pkn3 UTSW 2 30080059 missense probably benign 0.00
R8425:Pkn3 UTSW 2 30086501 critical splice donor site probably null
R8535:Pkn3 UTSW 2 30079924 critical splice acceptor site probably null
R8743:Pkn3 UTSW 2 30083306 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGTGAACCATCAACTTGCCTCC -3'
(R):5'- CCACGGCTATGCAAATGAAGTCCTC -3'

Sequencing Primer
(F):5'- CCAGCCAGAGGTGTTGTATG -3'
(R):5'- GCAAATGAAGTCCTCATGTGTTG -3'
Posted On2013-04-24