Incidental Mutation 'R0370:Mrrf'
ID30413
Institutional Source Beutler Lab
Gene Symbol Mrrf
Ensembl Gene ENSMUSG00000026887
Gene Namemitochondrial ribosome recycling factor
Synonyms2400002D02Rik
MMRRC Submission 038576-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.457) question?
Stock #R0370 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location36136389-36190647 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 36177113 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028250]
PDB Structure
Solution structure of RSGI RUH-021, a domain II of ribosome recycling factor from mouse cDNA [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000028250
SMART Domains Protein: ENSMUSP00000028250
Gene: ENSMUSG00000026887

DomainStartEndE-ValueType
low complexity region 58 66 N/A INTRINSIC
Pfam:RRF 99 261 3.1e-43 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ribosome recycling factor, which is a component of the mitochondrial translational machinery. The encoded protein, along with mitochondrial elongation factor 2, functions in ribosomal recycling at the termination of mitochondrial translation by mediating the disassembly of ribosomes from messenger RNA. A pseudogene of this gene has been identified on chromosome X. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l1 T C 8: 123,501,554 S666P probably damaging Het
B3gntl1 A T 11: 121,624,154 W263R probably damaging Het
Carmil3 A G 14: 55,495,442 N270S possibly damaging Het
Ctdp1 T C 18: 80,449,354 E642G probably damaging Het
Cyp2b9 A T 7: 26,210,106 K433M probably damaging Het
Dcc A G 18: 71,587,985 V435A possibly damaging Het
Defa26 A T 8: 21,618,859 M87L probably benign Het
Dnah11 T A 12: 117,995,227 I2974L probably benign Het
Dnah3 T C 7: 120,086,720 D131G possibly damaging Het
Dock6 A T 9: 21,814,565 S1447R probably benign Het
Dtl G T 1: 191,575,350 N17K probably benign Het
Grid2 A G 6: 64,345,734 I573V possibly damaging Het
Hoxa9 T C 6: 52,225,704 E134G possibly damaging Het
Kcnn3 A T 3: 89,667,092 N637I probably damaging Het
Ktn1 T C 14: 47,664,075 F97L probably benign Het
Lmbrd2 T C 15: 9,165,852 I271T probably damaging Het
Lrp6 A C 6: 134,479,766 I845S probably damaging Het
Med13l T A 5: 118,741,826 N994K probably benign Het
Mtmr1 G A X: 71,388,231 V125I probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Olfr1047 A T 2: 86,228,713 V86D probably damaging Het
Olfr309 T A 7: 86,306,849 N88I probably benign Het
Olfr639 T G 7: 104,012,059 L214F probably damaging Het
Paxip1 C A 5: 27,760,086 V659F probably damaging Het
Pclo T C 5: 14,521,090 V163A probably damaging Het
Pkn3 T A 2: 30,087,172 H641Q probably damaging Het
Plekhg6 G A 6: 125,370,660 R444C probably damaging Het
Rfx2 T C 17: 56,799,308 E175G probably benign Het
Samd9l A C 6: 3,377,264 probably benign Het
Sec14l5 A T 16: 5,180,706 T537S probably damaging Het
Serpinb9d A G 13: 33,195,966 E96G probably damaging Het
Setd4 T C 16: 93,591,118 E160G probably damaging Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Slc16a4 A G 3: 107,301,097 I308V possibly damaging Het
Slco2b1 T A 7: 99,690,437 N100Y probably damaging Het
Sptbn1 A T 11: 30,121,545 S1475R probably benign Het
Tecta T C 9: 42,366,804 D1136G probably benign Het
Tmem94 G C 11: 115,788,717 R273S probably damaging Het
Tns3 A G 11: 8,445,730 S1225P possibly damaging Het
Ugt2b36 A G 5: 87,091,975 Y184H probably benign Het
Vmn2r59 A T 7: 42,012,726 M555K probably benign Het
Other mutations in Mrrf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Mrrf APN 2 36141631 missense possibly damaging 0.82
R0239:Mrrf UTSW 2 36177281 splice site probably benign
R0671:Mrrf UTSW 2 36153698 missense probably benign 0.01
R2517:Mrrf UTSW 2 36189097 missense probably benign 0.07
R4823:Mrrf UTSW 2 36148030 missense possibly damaging 0.93
R5552:Mrrf UTSW 2 36147961 missense possibly damaging 0.85
R6056:Mrrf UTSW 2 36177221 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGGGTCAATGCTCAATGAGTC -3'
(R):5'- CACAGGCGAGATACACAGATGTTCC -3'

Sequencing Primer
(F):5'- tgctcatcttacttagtttcctcc -3'
(R):5'- GTACCTGCTTCTCGATGAGT -3'
Posted On2013-04-24