Mutagenetix > Incidental Mutations

Incidental Mutation 'R0370:Paxip1'

30418

Institutional Source

Beutler Lab

Gene Symbol

Paxip1

Ensembl Gene

ENSMUSG00000002221

Gene Name

PAX interacting (with transcription-activation domain) protein 1

Synonyms

D5Ertd149e, PTIP

MMRRC Submission

038576-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0370 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27740080-27791691 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 27760086 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 659 (V659F)

Ref Sequence

ENSEMBL: ENSMUSP00000002291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002291]

Predicted Effect

probably damaging
Transcript: ENSMUST00000002291
AA Change: V659F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000002291
Gene: ENSMUSG00000002221
AA Change: V659F

Domain	Start	End	E-Value	Type
BRCT	10	83	6.72e1	SMART
BRCT	96	173	8.83e-15	SMART
low complexity region	189	208	N/A	INTRINSIC
low complexity region	214	223	N/A	INTRINSIC
coiled coil region	489	547	N/A	INTRINSIC
BRCT	590	671	5.74e-14	SMART
BRCT	690	766	1.67e-15	SMART
BRCT	845	924	4.03e-9	SMART
BRCT	957	1046	3.54e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196641

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a nuclear-localized protein that contains six BRCT1 (C-terminal of breast cancer susceptibility protein) domains. The encoded protein is involved in the repair of DNA double-strand breaks and is necessary for progression through cell division. The protein also functions in the regulation of transcription by recruiting histone methyltransferases to gene promoters bound by the sequence-specific transcription factor paired box protein 2 (Pax2). [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous mutant mice are developmentally retarded and embyronic lethal by E9.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afg3l1	T	C	8: 123,501,554	S666P	probably damaging	Het
B3gntl1	A	T	11: 121,624,154	W263R	probably damaging	Het
Carmil3	A	G	14: 55,495,442	N270S	possibly damaging	Het
Ctdp1	T	C	18: 80,449,354	E642G	probably damaging	Het
Cyp2b9	A	T	7: 26,210,106	K433M	probably damaging	Het
Dcc	A	G	18: 71,587,985	V435A	possibly damaging	Het
Defa26	A	T	8: 21,618,859	M87L	probably benign	Het
Dnah11	T	A	12: 117,995,227	I2974L	probably benign	Het
Dnah3	T	C	7: 120,086,720	D131G	possibly damaging	Het
Dock6	A	T	9: 21,814,565	S1447R	probably benign	Het
Dtl	G	T	1: 191,575,350	N17K	probably benign	Het
Grid2	A	G	6: 64,345,734	I573V	possibly damaging	Het
Hoxa9	T	C	6: 52,225,704	E134G	possibly damaging	Het
Kcnn3	A	T	3: 89,667,092	N637I	probably damaging	Het
Ktn1	T	C	14: 47,664,075	F97L	probably benign	Het
Lmbrd2	T	C	15: 9,165,852	I271T	probably damaging	Het
Lrp6	A	C	6: 134,479,766	I845S	probably damaging	Het
Med13l	T	A	5: 118,741,826	N994K	probably benign	Het
Mrrf	A	T	2: 36,177,113		probably null	Het
Mtmr1	G	A	X: 71,388,231	V125I	probably damaging	Het
Nol8	C	T	13: 49,662,447	A677V	possibly damaging	Het
Olfr1047	A	T	2: 86,228,713	V86D	probably damaging	Het
Olfr309	T	A	7: 86,306,849	N88I	probably benign	Het
Olfr639	T	G	7: 104,012,059	L214F	probably damaging	Het
Pclo	T	C	5: 14,521,090	V163A	probably damaging	Het
Pkn3	T	A	2: 30,087,172	H641Q	probably damaging	Het
Plekhg6	G	A	6: 125,370,660	R444C	probably damaging	Het
Rfx2	T	C	17: 56,799,308	E175G	probably benign	Het
Samd9l	A	C	6: 3,377,264		probably benign	Het
Sec14l5	A	T	16: 5,180,706	T537S	probably damaging	Het
Serpinb9d	A	G	13: 33,195,966	E96G	probably damaging	Het
Setd4	T	C	16: 93,591,118	E160G	probably damaging	Het
Sf3b2	C	T	19: 5,274,824	D845N	probably damaging	Het
Slc16a4	A	G	3: 107,301,097	I308V	possibly damaging	Het
Slco2b1	T	A	7: 99,690,437	N100Y	probably damaging	Het
Sptbn1	A	T	11: 30,121,545	S1475R	probably benign	Het
Tecta	T	C	9: 42,366,804	D1136G	probably benign	Het
Tmem94	G	C	11: 115,788,717	R273S	probably damaging	Het
Tns3	A	G	11: 8,445,730	S1225P	possibly damaging	Het
Ugt2b36	A	G	5: 87,091,975	Y184H	probably benign	Het
Vmn2r59	A	T	7: 42,012,726	M555K	probably benign	Het

Other mutations in Paxip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Paxip1	APN	5	27772552	utr 3 prime	probably benign
IGL01705:Paxip1	APN	5	27748859	missense	probably damaging	1.00
IGL01844:Paxip1	APN	5	27751038	missense	probably benign	0.17
IGL02143:Paxip1	APN	5	27775598	utr 3 prime	probably benign
IGL02863:Paxip1	APN	5	27759395	missense	probably benign	0.30
IGL02903:Paxip1	APN	5	27748872	missense	probably damaging	1.00
IGL03008:Paxip1	APN	5	27752766	missense	probably benign	0.01
BB003:Paxip1	UTSW	5	27791209	missense	unknown
BB013:Paxip1	UTSW	5	27791209	missense	unknown
R0128:Paxip1	UTSW	5	27744185	splice site	probably benign
R0130:Paxip1	UTSW	5	27744185	splice site	probably benign
R0331:Paxip1	UTSW	5	27765232	missense	probably damaging	0.96
R0357:Paxip1	UTSW	5	27758623	splice site	probably benign
R0625:Paxip1	UTSW	5	27765942	nonsense	probably null
R1969:Paxip1	UTSW	5	27744136	missense	probably damaging	1.00
R2214:Paxip1	UTSW	5	27742501	missense	probably damaging	1.00
R3424:Paxip1	UTSW	5	27775673	utr 3 prime	probably benign
R3808:Paxip1	UTSW	5	27772029	unclassified	probably benign
R3809:Paxip1	UTSW	5	27772029	unclassified	probably benign
R3881:Paxip1	UTSW	5	27748839	missense	probably damaging	1.00
R3882:Paxip1	UTSW	5	27748839	missense	probably damaging	1.00
R4685:Paxip1	UTSW	5	27761677	splice site	probably null
R4692:Paxip1	UTSW	5	27772097	unclassified	probably benign
R4776:Paxip1	UTSW	5	27765206	missense	probably damaging	1.00
R5093:Paxip1	UTSW	5	27766284	missense	unknown
R5388:Paxip1	UTSW	5	27781455	utr 3 prime	probably benign
R5397:Paxip1	UTSW	5	27772004	unclassified	probably benign
R5553:Paxip1	UTSW	5	27775639	utr 3 prime	probably benign
R6151:Paxip1	UTSW	5	27761618	missense	probably damaging	1.00
R6216:Paxip1	UTSW	5	27766173	missense	unknown
R6276:Paxip1	UTSW	5	27761668	missense	probably damaging	1.00
R6290:Paxip1	UTSW	5	27765578	splice site	probably null
R6584:Paxip1	UTSW	5	27758452	missense	probably damaging	0.98
R6688:Paxip1	UTSW	5	27744137	missense	probably benign	0.18
R6908:Paxip1	UTSW	5	27791224	missense	possibly damaging	0.90
R6981:Paxip1	UTSW	5	27765768	nonsense	probably null
R7252:Paxip1	UTSW	5	27760086	missense	probably damaging	0.96
R7385:Paxip1	UTSW	5	27781420	critical splice donor site	probably null
R7585:Paxip1	UTSW	5	27772004	missense	unknown
R7665:Paxip1	UTSW	5	27765738	missense	unknown
R7926:Paxip1	UTSW	5	27791209	missense	unknown
R8169:Paxip1	UTSW	5	27772095	missense	unknown
R8335:Paxip1	UTSW	5	27766124	missense	unknown
X0066:Paxip1	UTSW	5	27766018	missense	unknown
Z1176:Paxip1	UTSW	5	27783729	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CAACTGGTGGCAAGTACCCATGAG -3'
(R):5'- ATGAAACATGTAGGTGCCCTGTGAG -3'

Sequencing Primer
(F):5'- GGCAAGTACCCATGAGTTCTATC -3'
(R):5'- CTGTGAGGCTTAGATCCCCTG -3'

Posted On

2013-04-24