Incidental Mutation 'R0370:Paxip1'
ID30418
Institutional Source Beutler Lab
Gene Symbol Paxip1
Ensembl Gene ENSMUSG00000002221
Gene NamePAX interacting (with transcription-activation domain) protein 1
SynonymsD5Ertd149e, PTIP
MMRRC Submission 038576-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0370 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location27740080-27791691 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 27760086 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 659 (V659F)
Ref Sequence ENSEMBL: ENSMUSP00000002291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002291]
Predicted Effect probably damaging
Transcript: ENSMUST00000002291
AA Change: V659F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002291
Gene: ENSMUSG00000002221
AA Change: V659F

DomainStartEndE-ValueType
BRCT 10 83 6.72e1 SMART
BRCT 96 173 8.83e-15 SMART
low complexity region 189 208 N/A INTRINSIC
low complexity region 214 223 N/A INTRINSIC
coiled coil region 489 547 N/A INTRINSIC
BRCT 590 671 5.74e-14 SMART
BRCT 690 766 1.67e-15 SMART
BRCT 845 924 4.03e-9 SMART
BRCT 957 1046 3.54e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196641
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a nuclear-localized protein that contains six BRCT1 (C-terminal of breast cancer susceptibility protein) domains. The encoded protein is involved in the repair of DNA double-strand breaks and is necessary for progression through cell division. The protein also functions in the regulation of transcription by recruiting histone methyltransferases to gene promoters bound by the sequence-specific transcription factor paired box protein 2 (Pax2). [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous mutant mice are developmentally retarded and embyronic lethal by E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l1 T C 8: 123,501,554 S666P probably damaging Het
B3gntl1 A T 11: 121,624,154 W263R probably damaging Het
Carmil3 A G 14: 55,495,442 N270S possibly damaging Het
Ctdp1 T C 18: 80,449,354 E642G probably damaging Het
Cyp2b9 A T 7: 26,210,106 K433M probably damaging Het
Dcc A G 18: 71,587,985 V435A possibly damaging Het
Defa26 A T 8: 21,618,859 M87L probably benign Het
Dnah11 T A 12: 117,995,227 I2974L probably benign Het
Dnah3 T C 7: 120,086,720 D131G possibly damaging Het
Dock6 A T 9: 21,814,565 S1447R probably benign Het
Dtl G T 1: 191,575,350 N17K probably benign Het
Grid2 A G 6: 64,345,734 I573V possibly damaging Het
Hoxa9 T C 6: 52,225,704 E134G possibly damaging Het
Kcnn3 A T 3: 89,667,092 N637I probably damaging Het
Ktn1 T C 14: 47,664,075 F97L probably benign Het
Lmbrd2 T C 15: 9,165,852 I271T probably damaging Het
Lrp6 A C 6: 134,479,766 I845S probably damaging Het
Med13l T A 5: 118,741,826 N994K probably benign Het
Mrrf A T 2: 36,177,113 probably null Het
Mtmr1 G A X: 71,388,231 V125I probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Olfr1047 A T 2: 86,228,713 V86D probably damaging Het
Olfr309 T A 7: 86,306,849 N88I probably benign Het
Olfr639 T G 7: 104,012,059 L214F probably damaging Het
Pclo T C 5: 14,521,090 V163A probably damaging Het
Pkn3 T A 2: 30,087,172 H641Q probably damaging Het
Plekhg6 G A 6: 125,370,660 R444C probably damaging Het
Rfx2 T C 17: 56,799,308 E175G probably benign Het
Samd9l A C 6: 3,377,264 probably benign Het
Sec14l5 A T 16: 5,180,706 T537S probably damaging Het
Serpinb9d A G 13: 33,195,966 E96G probably damaging Het
Setd4 T C 16: 93,591,118 E160G probably damaging Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Slc16a4 A G 3: 107,301,097 I308V possibly damaging Het
Slco2b1 T A 7: 99,690,437 N100Y probably damaging Het
Sptbn1 A T 11: 30,121,545 S1475R probably benign Het
Tecta T C 9: 42,366,804 D1136G probably benign Het
Tmem94 G C 11: 115,788,717 R273S probably damaging Het
Tns3 A G 11: 8,445,730 S1225P possibly damaging Het
Ugt2b36 A G 5: 87,091,975 Y184H probably benign Het
Vmn2r59 A T 7: 42,012,726 M555K probably benign Het
Other mutations in Paxip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Paxip1 APN 5 27772552 utr 3 prime probably benign
IGL01705:Paxip1 APN 5 27748859 missense probably damaging 1.00
IGL01844:Paxip1 APN 5 27751038 missense probably benign 0.17
IGL02143:Paxip1 APN 5 27775598 utr 3 prime probably benign
IGL02863:Paxip1 APN 5 27759395 missense probably benign 0.30
IGL02903:Paxip1 APN 5 27748872 missense probably damaging 1.00
IGL03008:Paxip1 APN 5 27752766 missense probably benign 0.01
R0128:Paxip1 UTSW 5 27744185 splice site probably benign
R0130:Paxip1 UTSW 5 27744185 splice site probably benign
R0331:Paxip1 UTSW 5 27765232 missense probably damaging 0.96
R0357:Paxip1 UTSW 5 27758623 splice site probably benign
R0625:Paxip1 UTSW 5 27765942 nonsense probably null
R1969:Paxip1 UTSW 5 27744136 missense probably damaging 1.00
R2214:Paxip1 UTSW 5 27742501 missense probably damaging 1.00
R3424:Paxip1 UTSW 5 27775673 utr 3 prime probably benign
R3808:Paxip1 UTSW 5 27772029 unclassified probably benign
R3809:Paxip1 UTSW 5 27772029 unclassified probably benign
R3881:Paxip1 UTSW 5 27748839 missense probably damaging 1.00
R3882:Paxip1 UTSW 5 27748839 missense probably damaging 1.00
R4685:Paxip1 UTSW 5 27761677 splice site probably null
R4692:Paxip1 UTSW 5 27772097 unclassified probably benign
R4776:Paxip1 UTSW 5 27765206 missense probably damaging 1.00
R5093:Paxip1 UTSW 5 27766284 missense unknown
R5388:Paxip1 UTSW 5 27781455 utr 3 prime probably benign
R5397:Paxip1 UTSW 5 27772004 unclassified probably benign
R5553:Paxip1 UTSW 5 27775639 utr 3 prime probably benign
R6151:Paxip1 UTSW 5 27761618 missense probably damaging 1.00
R6216:Paxip1 UTSW 5 27766173 missense unknown
R6276:Paxip1 UTSW 5 27761668 missense probably damaging 1.00
R6290:Paxip1 UTSW 5 27765578 splice site probably null
R6584:Paxip1 UTSW 5 27758452 missense probably damaging 0.98
R6688:Paxip1 UTSW 5 27744137 missense probably benign 0.18
R6908:Paxip1 UTSW 5 27791224 missense possibly damaging 0.90
R6981:Paxip1 UTSW 5 27765768 nonsense probably null
R7252:Paxip1 UTSW 5 27760086 missense probably damaging 0.96
R7385:Paxip1 UTSW 5 27781420 critical splice donor site probably null
R7585:Paxip1 UTSW 5 27772004 missense unknown
R7665:Paxip1 UTSW 5 27765738 missense unknown
X0066:Paxip1 UTSW 5 27766018 missense unknown
Predicted Primers PCR Primer
(F):5'- CAACTGGTGGCAAGTACCCATGAG -3'
(R):5'- ATGAAACATGTAGGTGCCCTGTGAG -3'

Sequencing Primer
(F):5'- GGCAAGTACCCATGAGTTCTATC -3'
(R):5'- CTGTGAGGCTTAGATCCCCTG -3'
Posted On2013-04-24