Incidental Mutation 'R0370:Hoxa9'
ID30421
Institutional Source Beutler Lab
Gene Symbol Hoxa9
Ensembl Gene ENSMUSG00000038227
Gene Namehomeobox A9
SynonymsD6a9, Hox-1.7
MMRRC Submission 038576-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.918) question?
Stock #R0370 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location52223100-52231089 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52225704 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 134 (E134G)
Ref Sequence ENSEMBL: ENSMUSP00000046939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048680] [ENSMUST00000114425] [ENSMUST00000150041]
PDB Structure Crystal Structure of HoxA9 and Pbx1 homeodomains bound to DNA [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048680
AA Change: E134G

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000046939
Gene: ENSMUSG00000038227
AA Change: E134G

DomainStartEndE-ValueType
Pfam:Hox9_act 1 192 3.8e-71 PFAM
HOX 205 267 3.3e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083509
Predicted Effect probably benign
Transcript: ENSMUST00000114425
SMART Domains Protein: ENSMUSP00000110068
Gene: ENSMUSG00000038227

DomainStartEndE-ValueType
Pfam:Hox9_act 1 105 5.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150041
SMART Domains Protein: ENSMUSP00000140519
Gene: ENSMUSG00000038236

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
low complexity region 43 56 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174115
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is located in a cluster of developmentally and temporally regulated genes on chromosome 6 encoding proteins involved in pattern formation. These proteins contain a characteristic DNA-binding motif called a homeodomain and function in transcriptional regulation. There are four distinct clusters of similar genes on chromosomes 2, 6, 11, and 15. The protein encoded by this gene is important for hematopoeisis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit homeotic transformations affecting lumbar vertebrae, reduced spleen and thymus weights, and defects in myeloid, erythroid, and lymphoid hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l1 T C 8: 123,501,554 S666P probably damaging Het
B3gntl1 A T 11: 121,624,154 W263R probably damaging Het
Carmil3 A G 14: 55,495,442 N270S possibly damaging Het
Ctdp1 T C 18: 80,449,354 E642G probably damaging Het
Cyp2b9 A T 7: 26,210,106 K433M probably damaging Het
Dcc A G 18: 71,587,985 V435A possibly damaging Het
Defa26 A T 8: 21,618,859 M87L probably benign Het
Dnah11 T A 12: 117,995,227 I2974L probably benign Het
Dnah3 T C 7: 120,086,720 D131G possibly damaging Het
Dock6 A T 9: 21,814,565 S1447R probably benign Het
Dtl G T 1: 191,575,350 N17K probably benign Het
Grid2 A G 6: 64,345,734 I573V possibly damaging Het
Kcnn3 A T 3: 89,667,092 N637I probably damaging Het
Ktn1 T C 14: 47,664,075 F97L probably benign Het
Lmbrd2 T C 15: 9,165,852 I271T probably damaging Het
Lrp6 A C 6: 134,479,766 I845S probably damaging Het
Med13l T A 5: 118,741,826 N994K probably benign Het
Mrrf A T 2: 36,177,113 probably null Het
Mtmr1 G A X: 71,388,231 V125I probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Olfr1047 A T 2: 86,228,713 V86D probably damaging Het
Olfr309 T A 7: 86,306,849 N88I probably benign Het
Olfr639 T G 7: 104,012,059 L214F probably damaging Het
Paxip1 C A 5: 27,760,086 V659F probably damaging Het
Pclo T C 5: 14,521,090 V163A probably damaging Het
Pkn3 T A 2: 30,087,172 H641Q probably damaging Het
Plekhg6 G A 6: 125,370,660 R444C probably damaging Het
Rfx2 T C 17: 56,799,308 E175G probably benign Het
Samd9l A C 6: 3,377,264 probably benign Het
Sec14l5 A T 16: 5,180,706 T537S probably damaging Het
Serpinb9d A G 13: 33,195,966 E96G probably damaging Het
Setd4 T C 16: 93,591,118 E160G probably damaging Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Slc16a4 A G 3: 107,301,097 I308V possibly damaging Het
Slco2b1 T A 7: 99,690,437 N100Y probably damaging Het
Sptbn1 A T 11: 30,121,545 S1475R probably benign Het
Tecta T C 9: 42,366,804 D1136G probably benign Het
Tmem94 G C 11: 115,788,717 R273S probably damaging Het
Tns3 A G 11: 8,445,730 S1225P possibly damaging Het
Ugt2b36 A G 5: 87,091,975 Y184H probably benign Het
Vmn2r59 A T 7: 42,012,726 M555K probably benign Het
Other mutations in Hoxa9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0727:Hoxa9 UTSW 6 52224314 missense probably damaging 0.99
R1173:Hoxa9 UTSW 6 52225713 missense probably damaging 0.99
R1174:Hoxa9 UTSW 6 52225713 missense probably damaging 0.99
R1175:Hoxa9 UTSW 6 52225713 missense probably damaging 0.99
R4611:Hoxa9 UTSW 6 52225710 missense probably damaging 1.00
R5857:Hoxa9 UTSW 6 52224297 missense probably damaging 1.00
R7679:Hoxa9 UTSW 6 52224308 missense probably damaging 0.99
R7756:Hoxa9 UTSW 6 52225562 missense probably benign 0.17
R7758:Hoxa9 UTSW 6 52225562 missense probably benign 0.17
R7922:Hoxa9 UTSW 6 52224309 missense possibly damaging 0.92
R8398:Hoxa9 UTSW 6 52224423 missense probably damaging 0.99
R8474:Hoxa9 UTSW 6 52225526 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACCGCCCAAAGTCTGTCTGTC -3'
(R):5'- GACTTCAGTCCTTGCAGCTTCCAG -3'

Sequencing Primer
(F):5'- TTCTCGGACCCTAGATCCAGAG -3'
(R):5'- TTGCAGCTTCCAGTCCAAGG -3'
Posted On2013-04-24