Incidental Mutation 'R0370:Olfr309'
ID30427
Institutional Source Beutler Lab
Gene Symbol Olfr309
Ensembl Gene ENSMUSG00000054054
Gene Nameolfactory receptor 309
SynonymsGA_x6K02T2NHDJ-9801340-9802266, MOR251-4P
MMRRC Submission 038576-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R0370 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location86304474-86313708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86306849 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 88 (N88I)
Ref Sequence ENSEMBL: ENSMUSP00000134377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055690] [ENSMUST00000174158]
Predicted Effect probably benign
Transcript: ENSMUST00000055690
AA Change: N88I

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000061929
Gene: ENSMUSG00000054054
AA Change: N88I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 303 4.5e-11 PFAM
Pfam:7tm_1 39 288 1.5e-26 PFAM
Pfam:7tm_4 137 281 7.9e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174158
AA Change: N88I

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134377
Gene: ENSMUSG00000054054
AA Change: N88I

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.6e-55 PFAM
Pfam:7TM_GPCR_Srsx 33 303 4.5e-11 PFAM
Pfam:7tm_1 39 288 2.4e-18 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l1 T C 8: 123,501,554 S666P probably damaging Het
B3gntl1 A T 11: 121,624,154 W263R probably damaging Het
Carmil3 A G 14: 55,495,442 N270S possibly damaging Het
Ctdp1 T C 18: 80,449,354 E642G probably damaging Het
Cyp2b9 A T 7: 26,210,106 K433M probably damaging Het
Dcc A G 18: 71,587,985 V435A possibly damaging Het
Defa26 A T 8: 21,618,859 M87L probably benign Het
Dnah11 T A 12: 117,995,227 I2974L probably benign Het
Dnah3 T C 7: 120,086,720 D131G possibly damaging Het
Dock6 A T 9: 21,814,565 S1447R probably benign Het
Dtl G T 1: 191,575,350 N17K probably benign Het
Grid2 A G 6: 64,345,734 I573V possibly damaging Het
Hoxa9 T C 6: 52,225,704 E134G possibly damaging Het
Kcnn3 A T 3: 89,667,092 N637I probably damaging Het
Ktn1 T C 14: 47,664,075 F97L probably benign Het
Lmbrd2 T C 15: 9,165,852 I271T probably damaging Het
Lrp6 A C 6: 134,479,766 I845S probably damaging Het
Med13l T A 5: 118,741,826 N994K probably benign Het
Mrrf A T 2: 36,177,113 probably null Het
Mtmr1 G A X: 71,388,231 V125I probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Olfr1047 A T 2: 86,228,713 V86D probably damaging Het
Olfr639 T G 7: 104,012,059 L214F probably damaging Het
Paxip1 C A 5: 27,760,086 V659F probably damaging Het
Pclo T C 5: 14,521,090 V163A probably damaging Het
Pkn3 T A 2: 30,087,172 H641Q probably damaging Het
Plekhg6 G A 6: 125,370,660 R444C probably damaging Het
Rfx2 T C 17: 56,799,308 E175G probably benign Het
Samd9l A C 6: 3,377,264 probably benign Het
Sec14l5 A T 16: 5,180,706 T537S probably damaging Het
Serpinb9d A G 13: 33,195,966 E96G probably damaging Het
Setd4 T C 16: 93,591,118 E160G probably damaging Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Slc16a4 A G 3: 107,301,097 I308V possibly damaging Het
Slco2b1 T A 7: 99,690,437 N100Y probably damaging Het
Sptbn1 A T 11: 30,121,545 S1475R probably benign Het
Tecta T C 9: 42,366,804 D1136G probably benign Het
Tmem94 G C 11: 115,788,717 R273S probably damaging Het
Tns3 A G 11: 8,445,730 S1225P possibly damaging Het
Ugt2b36 A G 5: 87,091,975 Y184H probably benign Het
Vmn2r59 A T 7: 42,012,726 M555K probably benign Het
Other mutations in Olfr309
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Olfr309 APN 7 86307051 missense probably damaging 1.00
R1869:Olfr309 UTSW 7 86306667 missense possibly damaging 0.96
R2047:Olfr309 UTSW 7 86306804 missense probably damaging 1.00
R3939:Olfr309 UTSW 7 86306229 missense probably benign 0.00
R4562:Olfr309 UTSW 7 86307152 start gained probably benign
R4640:Olfr309 UTSW 7 86307066 missense probably benign 0.01
R4811:Olfr309 UTSW 7 86306958 missense probably benign 0.41
R4867:Olfr309 UTSW 7 86306283 missense probably benign 0.00
R4954:Olfr309 UTSW 7 86306601 missense probably benign 0.01
R5784:Olfr309 UTSW 7 86306535 missense probably damaging 1.00
R6043:Olfr309 UTSW 7 86306339 missense probably damaging 0.97
R6498:Olfr309 UTSW 7 86307018 missense probably benign
R6849:Olfr309 UTSW 7 86307040 missense possibly damaging 0.54
R7238:Olfr309 UTSW 7 86306591 missense probably damaging 1.00
R7811:Olfr309 UTSW 7 86306346 missense probably damaging 1.00
R7917:Olfr309 UTSW 7 86306478 missense probably damaging 1.00
R8010:Olfr309 UTSW 7 86307052 missense probably benign 0.24
R8271:Olfr309 UTSW 7 86306754 missense probably benign 0.13
T0975:Olfr309 UTSW 7 86306284 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCATCACCTCATTGACTCTTACAGGAC -3'
(R):5'- ACCTTGTGGCTCTACTTGGTAATATGCT -3'

Sequencing Primer
(F):5'- TGCACCCAGGAATTGGTTAC -3'
(R):5'- ATATGCTAATTGTTGTTGCCATAATC -3'
Posted On2013-04-24