Incidental Mutation 'R0370:Slco2b1'
ID30428
Institutional Source Beutler Lab
Gene Symbol Slco2b1
Ensembl Gene ENSMUSG00000030737
Gene Namesolute carrier organic anion transporter family, member 2b1
SynonymsOATP-B, Slc21a9
MMRRC Submission 038576-MU
Accession Numbers

Genbank: NM_175316; MGI: 1351872

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0370 (G1)
Quality Score217
Status Not validated
Chromosome7
Chromosomal Location99657804-99711340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99690437 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 100 (N100Y)
Ref Sequence ENSEMBL: ENSMUSP00000146717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032985] [ENSMUST00000107086] [ENSMUST00000107088] [ENSMUST00000137914] [ENSMUST00000145381] [ENSMUST00000207090] [ENSMUST00000208225]
Predicted Effect probably damaging
Transcript: ENSMUST00000032985
AA Change: N86Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032985
Gene: ENSMUSG00000030737
AA Change: N86Y

DomainStartEndE-ValueType
Pfam:OATP 40 637 9.3e-189 PFAM
Pfam:MFS_1 44 468 1.9e-17 PFAM
transmembrane domain 640 662 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107086
AA Change: N86Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102701
Gene: ENSMUSG00000030737
AA Change: N86Y

DomainStartEndE-ValueType
Pfam:OATP 40 637 9.3e-189 PFAM
Pfam:MFS_1 44 468 1.9e-17 PFAM
transmembrane domain 640 662 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107088
AA Change: N96Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102703
Gene: ENSMUSG00000030737
AA Change: N96Y

DomainStartEndE-ValueType
Pfam:OATP 52 646 3.6e-182 PFAM
Pfam:MFS_1 53 476 2e-17 PFAM
transmembrane domain 650 672 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137914
SMART Domains Protein: ENSMUSP00000115872
Gene: ENSMUSG00000030737

DomainStartEndE-ValueType
Pfam:OATP 54 85 3.9e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000145381
AA Change: N100Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123439
Gene: ENSMUSG00000030737
AA Change: N100Y

DomainStartEndE-ValueType
Pfam:OATP 54 150 6.5e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207090
Predicted Effect probably damaging
Transcript: ENSMUST00000208225
AA Change: N100Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208250
Predicted Effect unknown
Transcript: ENSMUST00000208713
AA Change: N49Y
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the organic anion-transporting polypeptide family of membrane proteins. The protein encoded by this locus may function in regulation of placental uptake of sulfated steroids. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2010]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l1 T C 8: 123,501,554 S666P probably damaging Het
B3gntl1 A T 11: 121,624,154 W263R probably damaging Het
Carmil3 A G 14: 55,495,442 N270S possibly damaging Het
Ctdp1 T C 18: 80,449,354 E642G probably damaging Het
Cyp2b9 A T 7: 26,210,106 K433M probably damaging Het
Dcc A G 18: 71,587,985 V435A possibly damaging Het
Defa26 A T 8: 21,618,859 M87L probably benign Het
Dnah11 T A 12: 117,995,227 I2974L probably benign Het
Dnah3 T C 7: 120,086,720 D131G possibly damaging Het
Dock6 A T 9: 21,814,565 S1447R probably benign Het
Dtl G T 1: 191,575,350 N17K probably benign Het
Grid2 A G 6: 64,345,734 I573V possibly damaging Het
Hoxa9 T C 6: 52,225,704 E134G possibly damaging Het
Kcnn3 A T 3: 89,667,092 N637I probably damaging Het
Ktn1 T C 14: 47,664,075 F97L probably benign Het
Lmbrd2 T C 15: 9,165,852 I271T probably damaging Het
Lrp6 A C 6: 134,479,766 I845S probably damaging Het
Med13l T A 5: 118,741,826 N994K probably benign Het
Mrrf A T 2: 36,177,113 probably null Het
Mtmr1 G A X: 71,388,231 V125I probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Olfr1047 A T 2: 86,228,713 V86D probably damaging Het
Olfr309 T A 7: 86,306,849 N88I probably benign Het
Olfr639 T G 7: 104,012,059 L214F probably damaging Het
Paxip1 C A 5: 27,760,086 V659F probably damaging Het
Pclo T C 5: 14,521,090 V163A probably damaging Het
Pkn3 T A 2: 30,087,172 H641Q probably damaging Het
Plekhg6 G A 6: 125,370,660 R444C probably damaging Het
Rfx2 T C 17: 56,799,308 E175G probably benign Het
Samd9l A C 6: 3,377,264 probably benign Het
Sec14l5 A T 16: 5,180,706 T537S probably damaging Het
Serpinb9d A G 13: 33,195,966 E96G probably damaging Het
Setd4 T C 16: 93,591,118 E160G probably damaging Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Slc16a4 A G 3: 107,301,097 I308V possibly damaging Het
Sptbn1 A T 11: 30,121,545 S1475R probably benign Het
Tecta T C 9: 42,366,804 D1136G probably benign Het
Tmem94 G C 11: 115,788,717 R273S probably damaging Het
Tns3 A G 11: 8,445,730 S1225P possibly damaging Het
Ugt2b36 A G 5: 87,091,975 Y184H probably benign Het
Vmn2r59 A T 7: 42,012,726 M555K probably benign Het
Other mutations in Slco2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Slco2b1 APN 7 99660052 nonsense probably null
IGL00469:Slco2b1 APN 7 99660111 missense probably benign 0.21
IGL02625:Slco2b1 APN 7 99660123 splice site probably null
IGL03164:Slco2b1 APN 7 99685536 missense probably damaging 0.97
3-1:Slco2b1 UTSW 7 99685493 missense probably damaging 1.00
R0076:Slco2b1 UTSW 7 99685501 nonsense probably null
R0469:Slco2b1 UTSW 7 99661536 missense probably benign 0.30
R0510:Slco2b1 UTSW 7 99661536 missense probably benign 0.30
R1456:Slco2b1 UTSW 7 99664907 missense probably null
R1868:Slco2b1 UTSW 7 99686036 missense probably damaging 1.00
R2046:Slco2b1 UTSW 7 99690479 missense probably damaging 0.98
R4030:Slco2b1 UTSW 7 99682825 missense probably damaging 1.00
R4166:Slco2b1 UTSW 7 99660126 missense probably benign 0.30
R4406:Slco2b1 UTSW 7 99664889 missense probably benign 0.22
R4643:Slco2b1 UTSW 7 99667007 missense probably benign 0.00
R4770:Slco2b1 UTSW 7 99670949 critical splice donor site probably null
R4927:Slco2b1 UTSW 7 99685988 missense probably damaging 0.99
R5033:Slco2b1 UTSW 7 99660049 missense probably benign 0.14
R5166:Slco2b1 UTSW 7 99689013 missense possibly damaging 0.50
R5306:Slco2b1 UTSW 7 99688991 missense possibly damaging 0.79
R5358:Slco2b1 UTSW 7 99660044 missense unknown
R5389:Slco2b1 UTSW 7 99685925 missense probably damaging 0.98
R5874:Slco2b1 UTSW 7 99667094 missense probably benign
R6151:Slco2b1 UTSW 7 99690563 missense possibly damaging 0.46
R6163:Slco2b1 UTSW 7 99688899 missense probably damaging 1.00
R6192:Slco2b1 UTSW 7 99685572 missense probably damaging 1.00
R6489:Slco2b1 UTSW 7 99690555 nonsense probably null
R6651:Slco2b1 UTSW 7 99667169 missense probably benign 0.09
R7135:Slco2b1 UTSW 7 99695063 missense probably null 0.03
R7322:Slco2b1 UTSW 7 99691848 missense not run
R7353:Slco2b1 UTSW 7 99690557 missense possibly damaging 0.77
R7474:Slco2b1 UTSW 7 99664832 missense probably damaging 1.00
R7888:Slco2b1 UTSW 7 99688843 missense unknown
R8121:Slco2b1 UTSW 7 99685553 missense probably benign 0.00
R8751:Slco2b1 UTSW 7 99660052 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCACTCCAAGGTCAGTCAAAGGG -3'
(R):5'- CCATGACTTCTGATGGTGTCCGTTC -3'

Sequencing Primer
(F):5'- GTTCTCTAGCAAAGGGCTCCTAAG -3'
(R):5'- ATGGTGTCCGTTCACCTG -3'
Posted On2013-04-24