Incidental Mutation 'R0370:Defa26'
ID30431
Institutional Source Beutler Lab
Gene Symbol Defa26
Ensembl Gene ENSMUSG00000060070
Gene Namedefensin, alpha, 26
SynonymsDefcr26
MMRRC Submission 038576-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R0370 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location21618183-21618972 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21618859 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 87 (M87L)
Ref Sequence ENSEMBL: ENSMUSP00000073950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074343]
Predicted Effect probably benign
Transcript: ENSMUST00000074343
AA Change: M87L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073950
Gene: ENSMUSG00000060070
AA Change: M87L

DomainStartEndE-ValueType
Pfam:Defensin_propep 1 51 1.9e-24 PFAM
DEFSN 64 92 1.57e-8 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l1 T C 8: 123,501,554 S666P probably damaging Het
B3gntl1 A T 11: 121,624,154 W263R probably damaging Het
Carmil3 A G 14: 55,495,442 N270S possibly damaging Het
Ctdp1 T C 18: 80,449,354 E642G probably damaging Het
Cyp2b9 A T 7: 26,210,106 K433M probably damaging Het
Dcc A G 18: 71,587,985 V435A possibly damaging Het
Dnah11 T A 12: 117,995,227 I2974L probably benign Het
Dnah3 T C 7: 120,086,720 D131G possibly damaging Het
Dock6 A T 9: 21,814,565 S1447R probably benign Het
Dtl G T 1: 191,575,350 N17K probably benign Het
Grid2 A G 6: 64,345,734 I573V possibly damaging Het
Hoxa9 T C 6: 52,225,704 E134G possibly damaging Het
Kcnn3 A T 3: 89,667,092 N637I probably damaging Het
Ktn1 T C 14: 47,664,075 F97L probably benign Het
Lmbrd2 T C 15: 9,165,852 I271T probably damaging Het
Lrp6 A C 6: 134,479,766 I845S probably damaging Het
Med13l T A 5: 118,741,826 N994K probably benign Het
Mrrf A T 2: 36,177,113 probably null Het
Mtmr1 G A X: 71,388,231 V125I probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Olfr1047 A T 2: 86,228,713 V86D probably damaging Het
Olfr309 T A 7: 86,306,849 N88I probably benign Het
Olfr639 T G 7: 104,012,059 L214F probably damaging Het
Paxip1 C A 5: 27,760,086 V659F probably damaging Het
Pclo T C 5: 14,521,090 V163A probably damaging Het
Pkn3 T A 2: 30,087,172 H641Q probably damaging Het
Plekhg6 G A 6: 125,370,660 R444C probably damaging Het
Rfx2 T C 17: 56,799,308 E175G probably benign Het
Samd9l A C 6: 3,377,264 probably benign Het
Sec14l5 A T 16: 5,180,706 T537S probably damaging Het
Serpinb9d A G 13: 33,195,966 E96G probably damaging Het
Setd4 T C 16: 93,591,118 E160G probably damaging Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Slc16a4 A G 3: 107,301,097 I308V possibly damaging Het
Slco2b1 T A 7: 99,690,437 N100Y probably damaging Het
Sptbn1 A T 11: 30,121,545 S1475R probably benign Het
Tecta T C 9: 42,366,804 D1136G probably benign Het
Tmem94 G C 11: 115,788,717 R273S probably damaging Het
Tns3 A G 11: 8,445,730 S1225P possibly damaging Het
Ugt2b36 A G 5: 87,091,975 Y184H probably benign Het
Vmn2r59 A T 7: 42,012,726 M555K probably benign Het
Other mutations in Defa26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03230:Defa26 APN 8 21618298 missense probably damaging 1.00
IGL03255:Defa26 APN 8 21618241 missense probably damaging 1.00
R6539:Defa26 UTSW 8 21618246 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TCCTGGTAGAGTAATGTGGCTCCC -3'
(R):5'- TCAAAGACAGGAGCAGCTTATGTGC -3'

Sequencing Primer
(F):5'- AGTAATGTGGCTCCCTTAGCAAC -3'
(R):5'- TGTCTGAACATGGAGTCATCC -3'
Posted On2013-04-24