Incidental Mutation 'R0370:Afg3l1'
ID30433
Institutional Source Beutler Lab
Gene Symbol Afg3l1
Ensembl Gene ENSMUSG00000031967
Gene NameAFG3-like AAA ATPase 1
Synonyms3110061K15Rik, 1700047G05Rik
MMRRC Submission 038576-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R0370 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location123477903-123503916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123501554 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 666 (S666P)
Ref Sequence ENSEMBL: ENSMUSP00000001520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001520] [ENSMUST00000098320] [ENSMUST00000127664] [ENSMUST00000176155] [ENSMUST00000176286] [ENSMUST00000177240]
Predicted Effect probably damaging
Transcript: ENSMUST00000001520
AA Change: S666P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001520
Gene: ENSMUSG00000031967
AA Change: S666P

DomainStartEndE-ValueType
low complexity region 79 88 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
Pfam:FtsH_ext 141 235 1.2e-8 PFAM
low complexity region 265 279 N/A INTRINSIC
AAA 332 471 3.67e-24 SMART
Pfam:Peptidase_M41 533 736 6.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098320
SMART Domains Protein: ENSMUSP00000095924
Gene: ENSMUSG00000031967

DomainStartEndE-ValueType
low complexity region 79 88 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
Pfam:FtsH_ext 141 235 6.5e-9 PFAM
low complexity region 265 279 N/A INTRINSIC
AAA 332 471 3.67e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146795
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152469
Predicted Effect probably benign
Transcript: ENSMUST00000176155
SMART Domains Protein: ENSMUSP00000135524
Gene: ENSMUSG00000031970

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
Pfam:Dysbindin 44 189 3.6e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176286
SMART Domains Protein: ENSMUSP00000134757
Gene: ENSMUSG00000031970

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
Pfam:Dysbindin 44 96 3.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177240
SMART Domains Protein: ENSMUSP00000135216
Gene: ENSMUSG00000031970

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
Pfam:Dysbindin 44 101 4.5e-10 PFAM
Pfam:Dysbindin 96 142 2.7e-14 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and overtly normal with no detectable myelination defects or axonal degeneration in the brain and spinal cord and normal mitochondria in the spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B3gntl1 A T 11: 121,624,154 W263R probably damaging Het
Carmil3 A G 14: 55,495,442 N270S possibly damaging Het
Ctdp1 T C 18: 80,449,354 E642G probably damaging Het
Cyp2b9 A T 7: 26,210,106 K433M probably damaging Het
Dcc A G 18: 71,587,985 V435A possibly damaging Het
Defa26 A T 8: 21,618,859 M87L probably benign Het
Dnah11 T A 12: 117,995,227 I2974L probably benign Het
Dnah3 T C 7: 120,086,720 D131G possibly damaging Het
Dock6 A T 9: 21,814,565 S1447R probably benign Het
Dtl G T 1: 191,575,350 N17K probably benign Het
Grid2 A G 6: 64,345,734 I573V possibly damaging Het
Hoxa9 T C 6: 52,225,704 E134G possibly damaging Het
Kcnn3 A T 3: 89,667,092 N637I probably damaging Het
Ktn1 T C 14: 47,664,075 F97L probably benign Het
Lmbrd2 T C 15: 9,165,852 I271T probably damaging Het
Lrp6 A C 6: 134,479,766 I845S probably damaging Het
Med13l T A 5: 118,741,826 N994K probably benign Het
Mrrf A T 2: 36,177,113 probably null Het
Mtmr1 G A X: 71,388,231 V125I probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Olfr1047 A T 2: 86,228,713 V86D probably damaging Het
Olfr309 T A 7: 86,306,849 N88I probably benign Het
Olfr639 T G 7: 104,012,059 L214F probably damaging Het
Paxip1 C A 5: 27,760,086 V659F probably damaging Het
Pclo T C 5: 14,521,090 V163A probably damaging Het
Pkn3 T A 2: 30,087,172 H641Q probably damaging Het
Plekhg6 G A 6: 125,370,660 R444C probably damaging Het
Rfx2 T C 17: 56,799,308 E175G probably benign Het
Samd9l A C 6: 3,377,264 probably benign Het
Sec14l5 A T 16: 5,180,706 T537S probably damaging Het
Serpinb9d A G 13: 33,195,966 E96G probably damaging Het
Setd4 T C 16: 93,591,118 E160G probably damaging Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Slc16a4 A G 3: 107,301,097 I308V possibly damaging Het
Slco2b1 T A 7: 99,690,437 N100Y probably damaging Het
Sptbn1 A T 11: 30,121,545 S1475R probably benign Het
Tecta T C 9: 42,366,804 D1136G probably benign Het
Tmem94 G C 11: 115,788,717 R273S probably damaging Het
Tns3 A G 11: 8,445,730 S1225P possibly damaging Het
Ugt2b36 A G 5: 87,091,975 Y184H probably benign Het
Vmn2r59 A T 7: 42,012,726 M555K probably benign Het
Other mutations in Afg3l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Afg3l1 APN 8 123487389 missense probably benign 0.01
IGL01547:Afg3l1 APN 8 123501351 missense probably benign 0.17
IGL01612:Afg3l1 APN 8 123494853 missense probably benign 0.01
IGL01616:Afg3l1 APN 8 123502007 missense probably damaging 1.00
IGL01969:Afg3l1 APN 8 123480431 missense probably damaging 1.00
IGL01996:Afg3l1 APN 8 123501894 missense probably damaging 0.99
IGL02591:Afg3l1 APN 8 123486009 missense probably damaging 1.00
R1775:Afg3l1 UTSW 8 123492900 missense possibly damaging 0.89
R1817:Afg3l1 UTSW 8 123501931 missense probably damaging 0.99
R2152:Afg3l1 UTSW 8 123494836 missense probably damaging 1.00
R2516:Afg3l1 UTSW 8 123501954 missense probably damaging 0.99
R2844:Afg3l1 UTSW 8 123494939 intron probably benign
R3013:Afg3l1 UTSW 8 123484677 missense probably benign 0.27
R3732:Afg3l1 UTSW 8 123501233 missense probably damaging 1.00
R4565:Afg3l1 UTSW 8 123501869 nonsense probably null
R4603:Afg3l1 UTSW 8 123501935 missense probably benign 0.43
R4888:Afg3l1 UTSW 8 123488326 critical splice donor site probably null
R4932:Afg3l1 UTSW 8 123501380 missense probably damaging 1.00
R4970:Afg3l1 UTSW 8 123498653 missense probably benign 0.04
R5027:Afg3l1 UTSW 8 123489814 missense probably benign 0.00
R5133:Afg3l1 UTSW 8 123489793 missense probably benign 0.16
R5457:Afg3l1 UTSW 8 123489968 missense possibly damaging 0.88
R5911:Afg3l1 UTSW 8 123500039 missense possibly damaging 0.79
R6268:Afg3l1 UTSW 8 123492926 missense probably damaging 1.00
R7116:Afg3l1 UTSW 8 123489862 missense probably damaging 0.98
R7303:Afg3l1 UTSW 8 123501269 missense probably damaging 1.00
R7646:Afg3l1 UTSW 8 123493027 missense possibly damaging 0.85
Z1088:Afg3l1 UTSW 8 123488242 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TACACACGAGAGCAGCTCTTCGAC -3'
(R):5'- AGAACCTAAGCTAAGTAGGCCCACG -3'

Sequencing Primer
(F):5'- GTCAGATCACCACCGGAG -3'
(R):5'- GGAGATCAGCATGGTCCACAC -3'
Posted On2013-04-24