Incidental Mutation 'R0370:Dock6'
ID30434
Institutional Source Beutler Lab
Gene Symbol Dock6
Ensembl Gene ENSMUSG00000032198
Gene Namededicator of cytokinesis 6
Synonyms2410095B20Rik, C330023D02Rik, 4931431C02Rik
MMRRC Submission 038576-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.411) question?
Stock #R0370 (G1)
Quality Score201
Status Not validated
Chromosome9
Chromosomal Location21799860-21852635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21814565 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1447 (S1447R)
Ref Sequence ENSEMBL: ENSMUSP00000034728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034728] [ENSMUST00000217336]
Predicted Effect probably benign
Transcript: ENSMUST00000034728
AA Change: S1447R

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034728
Gene: ENSMUSG00000032198
AA Change: S1447R

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Pfam:DUF3398 63 155 4.7e-26 PFAM
low complexity region 419 429 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
Pfam:DOCK-C2 542 721 3.4e-46 PFAM
low complexity region 754 770 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 945 965 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
low complexity region 1123 1153 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
Pfam:DHR-2 1554 2080 6.6e-214 PFAM
low complexity region 2093 2107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184374
Predicted Effect unknown
Transcript: ENSMUST00000215729
AA Change: S211R
Predicted Effect probably benign
Transcript: ENSMUST00000217336
AA Change: S1478R

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis (DOCK) family of atypical guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with small GTPases and are components of intracellular signaling networks. The encoded protein is a group C DOCK protein and plays a role in actin cytoskeletal reorganization by activating the Rho GTPases Cdc42 and Rac1. Mutations in this gene are associated with Adams-Oliver syndrome 2. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l1 T C 8: 123,501,554 S666P probably damaging Het
B3gntl1 A T 11: 121,624,154 W263R probably damaging Het
Carmil3 A G 14: 55,495,442 N270S possibly damaging Het
Ctdp1 T C 18: 80,449,354 E642G probably damaging Het
Cyp2b9 A T 7: 26,210,106 K433M probably damaging Het
Dcc A G 18: 71,587,985 V435A possibly damaging Het
Defa26 A T 8: 21,618,859 M87L probably benign Het
Dnah11 T A 12: 117,995,227 I2974L probably benign Het
Dnah3 T C 7: 120,086,720 D131G possibly damaging Het
Dtl G T 1: 191,575,350 N17K probably benign Het
Grid2 A G 6: 64,345,734 I573V possibly damaging Het
Hoxa9 T C 6: 52,225,704 E134G possibly damaging Het
Kcnn3 A T 3: 89,667,092 N637I probably damaging Het
Ktn1 T C 14: 47,664,075 F97L probably benign Het
Lmbrd2 T C 15: 9,165,852 I271T probably damaging Het
Lrp6 A C 6: 134,479,766 I845S probably damaging Het
Med13l T A 5: 118,741,826 N994K probably benign Het
Mrrf A T 2: 36,177,113 probably null Het
Mtmr1 G A X: 71,388,231 V125I probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Olfr1047 A T 2: 86,228,713 V86D probably damaging Het
Olfr309 T A 7: 86,306,849 N88I probably benign Het
Olfr639 T G 7: 104,012,059 L214F probably damaging Het
Paxip1 C A 5: 27,760,086 V659F probably damaging Het
Pclo T C 5: 14,521,090 V163A probably damaging Het
Pkn3 T A 2: 30,087,172 H641Q probably damaging Het
Plekhg6 G A 6: 125,370,660 R444C probably damaging Het
Rfx2 T C 17: 56,799,308 E175G probably benign Het
Samd9l A C 6: 3,377,264 probably benign Het
Sec14l5 A T 16: 5,180,706 T537S probably damaging Het
Serpinb9d A G 13: 33,195,966 E96G probably damaging Het
Setd4 T C 16: 93,591,118 E160G probably damaging Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Slc16a4 A G 3: 107,301,097 I308V possibly damaging Het
Slco2b1 T A 7: 99,690,437 N100Y probably damaging Het
Sptbn1 A T 11: 30,121,545 S1475R probably benign Het
Tecta T C 9: 42,366,804 D1136G probably benign Het
Tmem94 G C 11: 115,788,717 R273S probably damaging Het
Tns3 A G 11: 8,445,730 S1225P possibly damaging Het
Ugt2b36 A G 5: 87,091,975 Y184H probably benign Het
Vmn2r59 A T 7: 42,012,726 M555K probably benign Het
Other mutations in Dock6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Dock6 APN 9 21846634 missense possibly damaging 0.50
IGL01025:Dock6 APN 9 21811807 missense possibly damaging 0.89
IGL01390:Dock6 APN 9 21803045 missense probably damaging 1.00
IGL02025:Dock6 APN 9 21809589 missense probably damaging 0.98
IGL02028:Dock6 APN 9 21838826 missense probably damaging 1.00
IGL02311:Dock6 APN 9 21844328 missense probably damaging 1.00
IGL02441:Dock6 APN 9 21841926 missense possibly damaging 0.77
IGL02504:Dock6 APN 9 21846655 missense probably benign 0.19
IGL02516:Dock6 APN 9 21802585 missense probably damaging 1.00
IGL02836:Dock6 APN 9 21801864 missense probably damaging 1.00
IGL02894:Dock6 APN 9 21811815 missense probably damaging 1.00
backwater UTSW 9 21824416 missense probably benign 0.29
bayfront UTSW 9 21821745 missense probably benign 0.29
marshland UTSW 9 21841603 missense probably benign 0.00
Shallows UTSW 9 21820622 missense probably benign
IGL03048:Dock6 UTSW 9 21809570 missense probably damaging 1.00
R0504:Dock6 UTSW 9 21802436 missense probably damaging 1.00
R0633:Dock6 UTSW 9 21844417 missense probably benign 0.00
R0634:Dock6 UTSW 9 21841527 missense probably damaging 1.00
R0671:Dock6 UTSW 9 21804627 splice site probably benign
R0839:Dock6 UTSW 9 21817892 missense probably benign 0.01
R0948:Dock6 UTSW 9 21801533 missense probably damaging 1.00
R1022:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1024:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1073:Dock6 UTSW 9 21846518 missense probably benign
R1463:Dock6 UTSW 9 21831906 missense probably damaging 1.00
R1481:Dock6 UTSW 9 21820622 missense probably benign
R1494:Dock6 UTSW 9 21814742 missense probably benign 0.34
R1547:Dock6 UTSW 9 21814588 missense probably damaging 1.00
R1654:Dock6 UTSW 9 21804843 missense probably damaging 0.98
R1782:Dock6 UTSW 9 21811846 missense probably damaging 1.00
R1905:Dock6 UTSW 9 21829574 missense probably benign 0.37
R1908:Dock6 UTSW 9 21841629 missense probably damaging 1.00
R1916:Dock6 UTSW 9 21813091 missense probably damaging 1.00
R2132:Dock6 UTSW 9 21846518 missense probably benign
R2197:Dock6 UTSW 9 21832881 missense probably damaging 1.00
R2316:Dock6 UTSW 9 21839677 missense probably damaging 0.98
R2341:Dock6 UTSW 9 21839486 splice site probably benign
R2519:Dock6 UTSW 9 21816333 missense possibly damaging 0.54
R2924:Dock6 UTSW 9 21809630 missense probably damaging 1.00
R2939:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R2940:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3078:Dock6 UTSW 9 21845754 splice site probably benign
R3081:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3810:Dock6 UTSW 9 21801577 missense probably damaging 1.00
R4246:Dock6 UTSW 9 21839490 splice site probably null
R4604:Dock6 UTSW 9 21802540 missense probably damaging 1.00
R4833:Dock6 UTSW 9 21844280 missense probably damaging 1.00
R4849:Dock6 UTSW 9 21811772 critical splice donor site probably null
R4896:Dock6 UTSW 9 21824437 missense possibly damaging 0.48
R4926:Dock6 UTSW 9 21845791 missense probably damaging 1.00
R5183:Dock6 UTSW 9 21841603 missense probably benign 0.00
R5211:Dock6 UTSW 9 21820352 missense probably benign 0.36
R5337:Dock6 UTSW 9 21829548 missense possibly damaging 0.93
R5353:Dock6 UTSW 9 21814786 missense probably benign 0.00
R5429:Dock6 UTSW 9 21832881 missense probably damaging 0.99
R5463:Dock6 UTSW 9 21809958 splice site probably null
R5476:Dock6 UTSW 9 21809589 missense probably damaging 0.98
R5511:Dock6 UTSW 9 21817407 missense possibly damaging 0.59
R5534:Dock6 UTSW 9 21803076 nonsense probably null
R5718:Dock6 UTSW 9 21824493 missense probably benign 0.11
R5823:Dock6 UTSW 9 21804828 missense probably damaging 0.99
R5831:Dock6 UTSW 9 21803036 missense probably damaging 1.00
R5887:Dock6 UTSW 9 21820394 missense probably damaging 0.96
R5930:Dock6 UTSW 9 21824416 missense probably benign 0.29
R6159:Dock6 UTSW 9 21821745 missense probably benign 0.29
R6633:Dock6 UTSW 9 21820331 missense probably benign 0.17
R6633:Dock6 UTSW 9 21821503 missense probably damaging 1.00
R6665:Dock6 UTSW 9 21839912 missense probably damaging 0.99
R6744:Dock6 UTSW 9 21831474 missense probably damaging 1.00
R6903:Dock6 UTSW 9 21809564 missense probably damaging 1.00
R6981:Dock6 UTSW 9 21845550 missense probably damaging 0.99
R7024:Dock6 UTSW 9 21820370 missense probably benign
R7030:Dock6 UTSW 9 21813079 missense probably damaging 1.00
R7045:Dock6 UTSW 9 21821811 missense probably damaging 1.00
R7139:Dock6 UTSW 9 21801276 missense probably damaging 1.00
R7356:Dock6 UTSW 9 21809899 missense probably damaging 1.00
R7400:Dock6 UTSW 9 21801807 missense possibly damaging 0.62
R7847:Dock6 UTSW 9 21801207 missense unknown
R7863:Dock6 UTSW 9 21846658 missense possibly damaging 0.85
R7991:Dock6 UTSW 9 21846562 missense probably damaging 1.00
R7992:Dock6 UTSW 9 21832839 critical splice donor site probably null
R8012:Dock6 UTSW 9 21846511 missense probably benign 0.16
R8184:Dock6 UTSW 9 21830300 missense possibly damaging 0.54
R8213:Dock6 UTSW 9 21831444 missense possibly damaging 0.77
R8560:Dock6 UTSW 9 21802836 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTCACGTCTCAGTTCATAACTGC -3'
(R):5'- TGATCTGACCCAGTGACATCACGAG -3'

Sequencing Primer
(F):5'- aggagcctgtccagcac -3'
(R):5'- AGTGACATCACGAGCTGTCC -3'
Posted On2013-04-24