Incidental Mutation 'R0370:Serpinb9d'
ID30441
Institutional Source Beutler Lab
Gene Symbol Serpinb9d
Ensembl Gene ENSMUSG00000054266
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9d
SynonymsAT2, ovalbumin, Spi9
MMRRC Submission 038576-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0370 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location33192959-33203129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33195966 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 96 (E96G)
Ref Sequence ENSEMBL: ENSMUSP00000067710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067198]
Predicted Effect probably damaging
Transcript: ENSMUST00000067198
AA Change: E96G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000067710
Gene: ENSMUSG00000054266
AA Change: E96G

DomainStartEndE-ValueType
SERPIN 13 377 1.79e-167 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l1 T C 8: 123,501,554 S666P probably damaging Het
B3gntl1 A T 11: 121,624,154 W263R probably damaging Het
Carmil3 A G 14: 55,495,442 N270S possibly damaging Het
Ctdp1 T C 18: 80,449,354 E642G probably damaging Het
Cyp2b9 A T 7: 26,210,106 K433M probably damaging Het
Dcc A G 18: 71,587,985 V435A possibly damaging Het
Defa26 A T 8: 21,618,859 M87L probably benign Het
Dnah11 T A 12: 117,995,227 I2974L probably benign Het
Dnah3 T C 7: 120,086,720 D131G possibly damaging Het
Dock6 A T 9: 21,814,565 S1447R probably benign Het
Dtl G T 1: 191,575,350 N17K probably benign Het
Grid2 A G 6: 64,345,734 I573V possibly damaging Het
Hoxa9 T C 6: 52,225,704 E134G possibly damaging Het
Kcnn3 A T 3: 89,667,092 N637I probably damaging Het
Ktn1 T C 14: 47,664,075 F97L probably benign Het
Lmbrd2 T C 15: 9,165,852 I271T probably damaging Het
Lrp6 A C 6: 134,479,766 I845S probably damaging Het
Med13l T A 5: 118,741,826 N994K probably benign Het
Mrrf A T 2: 36,177,113 probably null Het
Mtmr1 G A X: 71,388,231 V125I probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Olfr1047 A T 2: 86,228,713 V86D probably damaging Het
Olfr309 T A 7: 86,306,849 N88I probably benign Het
Olfr639 T G 7: 104,012,059 L214F probably damaging Het
Paxip1 C A 5: 27,760,086 V659F probably damaging Het
Pclo T C 5: 14,521,090 V163A probably damaging Het
Pkn3 T A 2: 30,087,172 H641Q probably damaging Het
Plekhg6 G A 6: 125,370,660 R444C probably damaging Het
Rfx2 T C 17: 56,799,308 E175G probably benign Het
Samd9l A C 6: 3,377,264 probably benign Het
Sec14l5 A T 16: 5,180,706 T537S probably damaging Het
Setd4 T C 16: 93,591,118 E160G probably damaging Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Slc16a4 A G 3: 107,301,097 I308V possibly damaging Het
Slco2b1 T A 7: 99,690,437 N100Y probably damaging Het
Sptbn1 A T 11: 30,121,545 S1475R probably benign Het
Tecta T C 9: 42,366,804 D1136G probably benign Het
Tmem94 G C 11: 115,788,717 R273S probably damaging Het
Tns3 A G 11: 8,445,730 S1225P possibly damaging Het
Ugt2b36 A G 5: 87,091,975 Y184H probably benign Het
Vmn2r59 A T 7: 42,012,726 M555K probably benign Het
Other mutations in Serpinb9d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Serpinb9d APN 13 33202671 splice site probably null
IGL01610:Serpinb9d APN 13 33198002 missense probably benign 0.12
IGL01702:Serpinb9d APN 13 33203023 missense probably damaging 1.00
IGL01833:Serpinb9d APN 13 33200705 missense probably damaging 1.00
IGL02029:Serpinb9d APN 13 33196529 missense possibly damaging 0.74
IGL03013:Serpinb9d APN 13 33196538 missense probably damaging 1.00
IGL03027:Serpinb9d APN 13 33202715 nonsense probably null
IGL03056:Serpinb9d APN 13 33202753 missense probably damaging 1.00
IGL03189:Serpinb9d APN 13 33202912 missense probably damaging 1.00
IGL03206:Serpinb9d APN 13 33198031 missense possibly damaging 0.61
R0217:Serpinb9d UTSW 13 33198022 missense possibly damaging 0.79
R1174:Serpinb9d UTSW 13 33200625 missense probably benign 0.23
R1175:Serpinb9d UTSW 13 33200625 missense probably benign 0.23
R1711:Serpinb9d UTSW 13 33200748 missense probably benign 0.03
R1716:Serpinb9d UTSW 13 33196517 missense probably damaging 1.00
R1874:Serpinb9d UTSW 13 33197963 splice site probably null
R2186:Serpinb9d UTSW 13 33203047 missense possibly damaging 0.82
R2497:Serpinb9d UTSW 13 33196517 missense probably damaging 1.00
R4198:Serpinb9d UTSW 13 33202674 splice site probably null
R4198:Serpinb9d UTSW 13 33202965 missense probably benign 0.01
R4199:Serpinb9d UTSW 13 33202674 splice site probably null
R4584:Serpinb9d UTSW 13 33200616 missense probably damaging 1.00
R4650:Serpinb9d UTSW 13 33202853 missense probably benign 0.00
R5573:Serpinb9d UTSW 13 33196440 critical splice acceptor site probably null
R5627:Serpinb9d UTSW 13 33202693 missense probably damaging 1.00
R6336:Serpinb9d UTSW 13 33194694 missense probably damaging 1.00
R6706:Serpinb9d UTSW 13 33196558 missense probably benign
R6948:Serpinb9d UTSW 13 33200723 missense possibly damaging 0.95
R7271:Serpinb9d UTSW 13 33194634 missense probably benign 0.43
R7336:Serpinb9d UTSW 13 33200719 missense probably benign 0.00
R7436:Serpinb9d UTSW 13 33195933 missense probably benign 0.35
R7675:Serpinb9d UTSW 13 33202776 nonsense probably null
R7874:Serpinb9d UTSW 13 33202671 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCAGAACCCCAGTTACTTGGCAGC -3'
(R):5'- TCCTTTCCCAGCCTTTGAAATGCAG -3'

Sequencing Primer
(F):5'- CAGCCTGAGTGATCTTGAAAATTCC -3'
(R):5'- CAGTTTCTATAGGGTCCTTTCCC -3'
Posted On2013-04-24