Incidental Mutation 'R0370:Setd4'
ID30447
Institutional Source Beutler Lab
Gene Symbol Setd4
Ensembl Gene ENSMUSG00000022948
Gene NameSET domain containing 4
SynonymsORF21
MMRRC Submission 038576-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0370 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location93583457-93604063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93591118 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 160 (E160G)
Ref Sequence ENSEMBL: ENSMUSP00000023669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023669] [ENSMUST00000113951]
Predicted Effect probably damaging
Transcript: ENSMUST00000023669
AA Change: E160G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023669
Gene: ENSMUSG00000022948
AA Change: E160G

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:SET 58 272 3.2e-11 PFAM
Pfam:Rubis-subs-bind 306 424 5.5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113951
AA Change: E160G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109584
Gene: ENSMUSG00000022948
AA Change: E160G

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:SET 58 272 9.1e-14 PFAM
Pfam:Rubis-subs-bind 308 424 1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156298
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l1 T C 8: 123,501,554 S666P probably damaging Het
B3gntl1 A T 11: 121,624,154 W263R probably damaging Het
Carmil3 A G 14: 55,495,442 N270S possibly damaging Het
Ctdp1 T C 18: 80,449,354 E642G probably damaging Het
Cyp2b9 A T 7: 26,210,106 K433M probably damaging Het
Dcc A G 18: 71,587,985 V435A possibly damaging Het
Defa26 A T 8: 21,618,859 M87L probably benign Het
Dnah11 T A 12: 117,995,227 I2974L probably benign Het
Dnah3 T C 7: 120,086,720 D131G possibly damaging Het
Dock6 A T 9: 21,814,565 S1447R probably benign Het
Dtl G T 1: 191,575,350 N17K probably benign Het
Grid2 A G 6: 64,345,734 I573V possibly damaging Het
Hoxa9 T C 6: 52,225,704 E134G possibly damaging Het
Kcnn3 A T 3: 89,667,092 N637I probably damaging Het
Ktn1 T C 14: 47,664,075 F97L probably benign Het
Lmbrd2 T C 15: 9,165,852 I271T probably damaging Het
Lrp6 A C 6: 134,479,766 I845S probably damaging Het
Med13l T A 5: 118,741,826 N994K probably benign Het
Mrrf A T 2: 36,177,113 probably null Het
Mtmr1 G A X: 71,388,231 V125I probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Olfr1047 A T 2: 86,228,713 V86D probably damaging Het
Olfr309 T A 7: 86,306,849 N88I probably benign Het
Olfr639 T G 7: 104,012,059 L214F probably damaging Het
Paxip1 C A 5: 27,760,086 V659F probably damaging Het
Pclo T C 5: 14,521,090 V163A probably damaging Het
Pkn3 T A 2: 30,087,172 H641Q probably damaging Het
Plekhg6 G A 6: 125,370,660 R444C probably damaging Het
Rfx2 T C 17: 56,799,308 E175G probably benign Het
Samd9l A C 6: 3,377,264 probably benign Het
Sec14l5 A T 16: 5,180,706 T537S probably damaging Het
Serpinb9d A G 13: 33,195,966 E96G probably damaging Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Slc16a4 A G 3: 107,301,097 I308V possibly damaging Het
Slco2b1 T A 7: 99,690,437 N100Y probably damaging Het
Sptbn1 A T 11: 30,121,545 S1475R probably benign Het
Tecta T C 9: 42,366,804 D1136G probably benign Het
Tmem94 G C 11: 115,788,717 R273S probably damaging Het
Tns3 A G 11: 8,445,730 S1225P possibly damaging Het
Ugt2b36 A G 5: 87,091,975 Y184H probably benign Het
Vmn2r59 A T 7: 42,012,726 M555K probably benign Het
Other mutations in Setd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Setd4 APN 16 93591239 missense probably damaging 1.00
IGL02217:Setd4 APN 16 93593295 missense probably damaging 1.00
R0573:Setd4 UTSW 16 93589946 missense probably benign
R1103:Setd4 UTSW 16 93585194 missense probably benign 0.01
R1631:Setd4 UTSW 16 93593248 nonsense probably null
R1826:Setd4 UTSW 16 93591299 nonsense probably null
R2356:Setd4 UTSW 16 93590983 missense probably damaging 1.00
R2360:Setd4 UTSW 16 93586234 splice site probably benign
R4362:Setd4 UTSW 16 93583686 splice site probably null
R4630:Setd4 UTSW 16 93591226 missense probably benign 0.00
R4823:Setd4 UTSW 16 93589950 missense probably benign 0.00
R5004:Setd4 UTSW 16 93591245 missense probably benign 0.02
R5257:Setd4 UTSW 16 93596333 missense probably damaging 0.98
R6667:Setd4 UTSW 16 93590030 missense probably benign 0.16
R6798:Setd4 UTSW 16 93589953 missense probably damaging 1.00
R7296:Setd4 UTSW 16 93583942 splice site probably null
R7313:Setd4 UTSW 16 93591244 missense probably benign 0.09
R7314:Setd4 UTSW 16 93587823 missense probably benign 0.13
R8786:Setd4 UTSW 16 93593274 missense not run
Predicted Primers PCR Primer
(F):5'- CTGTGATTCAGCAGGTCCAGGAAC -3'
(R):5'- AGGCAGACGACATTGTGAGAGTCC -3'

Sequencing Primer
(F):5'- TGCGGAAAGGCACTCCTG -3'
(R):5'- GACATTGTGAGAGTCCACACTTTAAC -3'
Posted On2013-04-24