Incidental Mutation 'R0370:Ctdp1'
ID30450
Institutional Source Beutler Lab
Gene Symbol Ctdp1
Ensembl Gene ENSMUSG00000033323
Gene NameCTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
Synonyms4930563P03Rik
MMRRC Submission 038576-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R0370 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location80407959-80469695 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80449354 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 642 (E642G)
Ref Sequence ENSEMBL: ENSMUSP00000038938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036229]
Predicted Effect probably damaging
Transcript: ENSMUST00000036229
AA Change: E642G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038938
Gene: ENSMUSG00000033323
AA Change: E642G

DomainStartEndE-ValueType
low complexity region 55 72 N/A INTRINSIC
CPDc 181 327 1.21e-62 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 568 587 N/A INTRINSIC
BRCT 621 708 9.62e-7 SMART
low complexity region 779 787 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
PDB:1ONV|B 890 921 2e-6 PDB
coiled coil region 936 959 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with the carboxy-terminus of the RAP74 subunit of transcription initiation factor TFIIF, and functions as a phosphatase that processively dephosphorylates the C-terminus of POLR2A (a subunit of RNA polymerase II), making it available for initiation of gene expression. Mutations in this gene are associated with congenital cataracts, facial dysmorphism and neuropathy syndrome (CCFDN). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l1 T C 8: 123,501,554 S666P probably damaging Het
B3gntl1 A T 11: 121,624,154 W263R probably damaging Het
Carmil3 A G 14: 55,495,442 N270S possibly damaging Het
Cyp2b9 A T 7: 26,210,106 K433M probably damaging Het
Dcc A G 18: 71,587,985 V435A possibly damaging Het
Defa26 A T 8: 21,618,859 M87L probably benign Het
Dnah11 T A 12: 117,995,227 I2974L probably benign Het
Dnah3 T C 7: 120,086,720 D131G possibly damaging Het
Dock6 A T 9: 21,814,565 S1447R probably benign Het
Dtl G T 1: 191,575,350 N17K probably benign Het
Grid2 A G 6: 64,345,734 I573V possibly damaging Het
Hoxa9 T C 6: 52,225,704 E134G possibly damaging Het
Kcnn3 A T 3: 89,667,092 N637I probably damaging Het
Ktn1 T C 14: 47,664,075 F97L probably benign Het
Lmbrd2 T C 15: 9,165,852 I271T probably damaging Het
Lrp6 A C 6: 134,479,766 I845S probably damaging Het
Med13l T A 5: 118,741,826 N994K probably benign Het
Mrrf A T 2: 36,177,113 probably null Het
Mtmr1 G A X: 71,388,231 V125I probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Olfr1047 A T 2: 86,228,713 V86D probably damaging Het
Olfr309 T A 7: 86,306,849 N88I probably benign Het
Olfr639 T G 7: 104,012,059 L214F probably damaging Het
Paxip1 C A 5: 27,760,086 V659F probably damaging Het
Pclo T C 5: 14,521,090 V163A probably damaging Het
Pkn3 T A 2: 30,087,172 H641Q probably damaging Het
Plekhg6 G A 6: 125,370,660 R444C probably damaging Het
Rfx2 T C 17: 56,799,308 E175G probably benign Het
Samd9l A C 6: 3,377,264 probably benign Het
Sec14l5 A T 16: 5,180,706 T537S probably damaging Het
Serpinb9d A G 13: 33,195,966 E96G probably damaging Het
Setd4 T C 16: 93,591,118 E160G probably damaging Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Slc16a4 A G 3: 107,301,097 I308V possibly damaging Het
Slco2b1 T A 7: 99,690,437 N100Y probably damaging Het
Sptbn1 A T 11: 30,121,545 S1475R probably benign Het
Tecta T C 9: 42,366,804 D1136G probably benign Het
Tmem94 G C 11: 115,788,717 R273S probably damaging Het
Tns3 A G 11: 8,445,730 S1225P possibly damaging Het
Ugt2b36 A G 5: 87,091,975 Y184H probably benign Het
Vmn2r59 A T 7: 42,012,726 M555K probably benign Het
Other mutations in Ctdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Ctdp1 APN 18 80458692 splice site probably null
IGL01695:Ctdp1 APN 18 80449626 missense probably damaging 1.00
IGL01865:Ctdp1 APN 18 80455984 missense probably damaging 1.00
IGL02009:Ctdp1 APN 18 80455972 missense probably damaging 1.00
IGL02419:Ctdp1 APN 18 80420584 missense probably damaging 1.00
IGL02580:Ctdp1 APN 18 80450090 missense probably benign 0.01
IGL02699:Ctdp1 APN 18 80450185 missense probably benign
IGL03117:Ctdp1 APN 18 80449501 missense probably damaging 0.98
IGL03301:Ctdp1 APN 18 80449634 nonsense probably null
IGL03385:Ctdp1 APN 18 80449918 missense probably damaging 1.00
R0374:Ctdp1 UTSW 18 80447422 critical splice donor site probably null
R0730:Ctdp1 UTSW 18 80450242 missense probably benign 0.00
R0894:Ctdp1 UTSW 18 80469521 missense probably benign 0.09
R1187:Ctdp1 UTSW 18 80449487 missense probably damaging 1.00
R1437:Ctdp1 UTSW 18 80450213 missense probably benign 0.01
R1988:Ctdp1 UTSW 18 80449401 missense possibly damaging 0.89
R2192:Ctdp1 UTSW 18 80449481 missense probably benign 0.30
R3709:Ctdp1 UTSW 18 80450213 nonsense probably null
R3724:Ctdp1 UTSW 18 80459267 missense probably benign 0.16
R3756:Ctdp1 UTSW 18 80452351 missense probably damaging 0.98
R4297:Ctdp1 UTSW 18 80449957 missense probably benign
R4298:Ctdp1 UTSW 18 80449957 missense probably benign
R4640:Ctdp1 UTSW 18 80451154 critical splice donor site probably null
R4841:Ctdp1 UTSW 18 80408726 missense unknown
R4842:Ctdp1 UTSW 18 80408726 missense unknown
R5007:Ctdp1 UTSW 18 80420480 missense probably damaging 0.99
R5055:Ctdp1 UTSW 18 80456088 missense probably damaging 1.00
R5219:Ctdp1 UTSW 18 80447460 missense probably damaging 1.00
R5870:Ctdp1 UTSW 18 80408686 missense unknown
R5896:Ctdp1 UTSW 18 80458788 missense probably damaging 1.00
R6242:Ctdp1 UTSW 18 80459212 missense probably damaging 1.00
R6255:Ctdp1 UTSW 18 80459297 critical splice acceptor site probably null
R6300:Ctdp1 UTSW 18 80459240 missense probably benign 0.26
R6431:Ctdp1 UTSW 18 80451255 missense probably damaging 0.96
R6462:Ctdp1 UTSW 18 80420474 missense probably damaging 0.98
R6512:Ctdp1 UTSW 18 80451263 missense probably damaging 1.00
R6537:Ctdp1 UTSW 18 80449551 missense probably benign
R6802:Ctdp1 UTSW 18 80420441 critical splice donor site probably null
R7477:Ctdp1 UTSW 18 80440714 splice site probably null
R8121:Ctdp1 UTSW 18 80456008 missense probably damaging 1.00
R8348:Ctdp1 UTSW 18 80450110 missense probably benign 0.00
R8350:Ctdp1 UTSW 18 80469279 missense probably benign 0.03
R8513:Ctdp1 UTSW 18 80449463 missense possibly damaging 0.49
X0020:Ctdp1 UTSW 18 80449990 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAAGATGCAGCGCACTGTGACC -3'
(R):5'- CGACGATGACCACTTGATACACCTC -3'

Sequencing Primer
(F):5'- GCACTGTGACCTAGCCTC -3'
(R):5'- TCGAGGAGATCCTGGTCC -3'
Posted On2013-04-24