Incidental Mutation 'R0371:Lactb2'
ID30451
Institutional Source Beutler Lab
Gene Symbol Lactb2
Ensembl Gene ENSMUSG00000025937
Gene Namelactamase, beta 2
SynonymsE430032H21Rik, Cgi-83
MMRRC Submission 038577-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R0371 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location13623330-13660546 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13650760 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 83 (S83P)
Ref Sequence ENSEMBL: ENSMUSP00000027071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027071]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027071
AA Change: S83P

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027071
Gene: ENSMUSG00000025937
AA Change: S83P

DomainStartEndE-ValueType
Lactamase_B 30 199 6.69e-30 SMART
Meta Mutation Damage Score 0.6950 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.6%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: Male mice homozygous for a null allele exhibit at 40 days of age preceeded by decreased body size, lethargy, enlarged and pale liver and hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 G A 16: 4,288,047 R1068C probably benign Het
Afmid C T 11: 117,835,140 probably benign Het
Aqr A G 2: 114,157,604 V159A possibly damaging Het
Atp6v0d2 G C 4: 19,880,033 T288R possibly damaging Het
Btnl1 T C 17: 34,381,057 V178A probably damaging Het
Ccdc110 T A 8: 45,942,806 M578K possibly damaging Het
Ccdc38 G T 10: 93,562,812 E51* probably null Het
Cep290 T A 10: 100,518,564 probably benign Het
Cilp2 T C 8: 69,881,606 E914G probably damaging Het
Col6a2 T C 10: 76,614,473 N208S probably benign Het
Ctrb1 T A 8: 111,687,151 I194F probably benign Het
Cyp4a12a C G 4: 115,326,683 R229G probably damaging Het
Dach1 C T 14: 97,969,903 V337M probably damaging Het
Dcbld2 A G 16: 58,450,823 N321S probably benign Het
Enpep C T 3: 129,283,867 probably null Het
Fat1 T C 8: 44,951,892 L560P probably damaging Het
Fdxr T C 11: 115,276,089 H58R possibly damaging Het
Filip1 G T 9: 79,860,091 P147T probably damaging Het
Fras1 G A 5: 96,555,331 E318K possibly damaging Het
Gm4759 A T 7: 106,422,779 C339S unknown Het
Grk2 T C 19: 4,291,586 probably null Het
Havcr1 T C 11: 46,752,589 I112T possibly damaging Het
Hjurp G A 1: 88,277,368 probably benign Het
Ildr2 G A 1: 166,303,564 V330I probably damaging Het
Ino80d T C 1: 63,057,956 probably benign Het
Iqsec1 A G 6: 90,670,403 probably benign Het
Irf2bpl C T 12: 86,881,643 W752* probably null Het
Kdr T A 5: 75,941,834 H1211L probably benign Het
Klri2 A G 6: 129,732,143 *249R probably null Het
Ktn1 A T 14: 47,724,003 K1054* probably null Het
Lrrc3b A T 14: 15,358,560 C15* probably null Het
Mrs2 T C 13: 24,993,095 I430V probably benign Het
Myo3b C T 2: 70,252,960 probably benign Het
Nbas C T 12: 13,331,095 T696I probably damaging Het
Nsun6 T C 2: 15,030,087 D240G probably damaging Het
Nup107 T C 10: 117,763,769 E615G probably damaging Het
Olfr1283 A T 2: 111,369,153 I174L probably benign Het
Olfr205 A G 16: 59,329,222 C96R possibly damaging Het
Olfr411 T A 11: 74,346,934 I217F probably damaging Het
Olfr447 A T 6: 42,911,938 R138S probably benign Het
Pabpc1l G A 2: 164,035,272 V256M probably benign Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Sik1 T C 17: 31,848,984 D409G probably benign Het
Slc22a22 A T 15: 57,249,735 D369E possibly damaging Het
Smg1 T A 7: 118,168,300 probably benign Het
Snap29 C A 16: 17,406,203 D27E probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Sorcs3 A G 19: 48,603,894 I333V probably benign Het
Spag7 A G 11: 70,664,796 M105T probably damaging Het
Srgap3 A T 6: 112,771,471 S407T probably damaging Het
Supt6 T C 11: 78,223,157 N854S probably benign Het
Syne2 T C 12: 75,933,845 S1460P probably damaging Het
Taok3 C T 5: 117,206,687 Q160* probably null Het
Tchhl1 C A 3: 93,469,577 A27E probably damaging Het
Tet1 T C 10: 62,878,399 D539G probably damaging Het
Tut1 T C 19: 8,962,773 F374L probably damaging Het
Unc5c C T 3: 141,827,522 P770S probably benign Het
Vmn2r101 T A 17: 19,590,132 N393K probably benign Het
Vmn2r94 T A 17: 18,257,294 H285L probably benign Het
Wdr62 G A 7: 30,242,158 S700L possibly damaging Het
Wscd1 A G 11: 71,788,723 D474G probably damaging Het
Zcchc7 A G 4: 44,762,190 N106S probably damaging Het
Zfp345 G T 2: 150,472,063 T518N possibly damaging Het
Zfp648 A T 1: 154,204,667 S191C possibly damaging Het
Zkscan8 C T 13: 21,526,674 E89K probably damaging Het
Other mutations in Lactb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Lactb2 APN 1 13660374 missense probably damaging 1.00
IGL00595:Lactb2 APN 1 13630126 missense probably benign 0.05
IGL00730:Lactb2 APN 1 13647516 splice site probably benign
R0782:Lactb2 UTSW 1 13647451 missense probably benign 0.18
R1670:Lactb2 UTSW 1 13660417 missense probably damaging 0.99
R2324:Lactb2 UTSW 1 13638296 missense probably damaging 1.00
R2418:Lactb2 UTSW 1 13660339 missense possibly damaging 0.93
R3500:Lactb2 UTSW 1 13660449 start codon destroyed probably null 1.00
R4345:Lactb2 UTSW 1 13660350 missense probably damaging 1.00
R4664:Lactb2 UTSW 1 13647400 missense probably damaging 1.00
R4665:Lactb2 UTSW 1 13647400 missense probably damaging 1.00
R4716:Lactb2 UTSW 1 13638395 missense probably damaging 1.00
R5363:Lactb2 UTSW 1 13630132 missense probably benign 0.22
R5658:Lactb2 UTSW 1 13627418 missense probably benign 0.03
R5734:Lactb2 UTSW 1 13660387 missense probably damaging 1.00
R5918:Lactb2 UTSW 1 13650730 missense probably benign 0.32
R6419:Lactb2 UTSW 1 13638235 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTATCAGCCTTCCAGCACCCTTG -3'
(R):5'- CCCGCCAGCCATAGTTCACATTTAC -3'

Sequencing Primer
(F):5'- GGCACAGTGCTTGCAAAC -3'
(R):5'- GTTCAAAGACAAAGTTTGCTTTTCC -3'
Posted On2013-04-24