Incidental Mutation 'R0371:Myo3b'
ID 30456
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
MMRRC Submission 038577-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0371 (G1)
Quality Score 203
Status Validated
Chromosome 2
Chromosomal Location 69869470-70259542 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 70083304 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably benign
Transcript: ENSMUST00000060208
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112243
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.6%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 G A 16: 4,105,911 (GRCm39) R1068C probably benign Het
Afmid C T 11: 117,725,966 (GRCm39) probably benign Het
Aqr A G 2: 113,988,085 (GRCm39) V159A possibly damaging Het
Atp6v0d2 G C 4: 19,880,033 (GRCm39) T288R possibly damaging Het
Btnl1 T C 17: 34,600,031 (GRCm39) V178A probably damaging Het
Ccdc110 T A 8: 46,395,843 (GRCm39) M578K possibly damaging Het
Ccdc38 G T 10: 93,398,674 (GRCm39) E51* probably null Het
Cep290 T A 10: 100,354,426 (GRCm39) probably benign Het
Cilp2 T C 8: 70,334,256 (GRCm39) E914G probably damaging Het
Col6a2 T C 10: 76,450,307 (GRCm39) N208S probably benign Het
Ctrb1 T A 8: 112,413,783 (GRCm39) I194F probably benign Het
Cyp4a12a C G 4: 115,183,880 (GRCm39) R229G probably damaging Het
Dach1 C T 14: 98,207,339 (GRCm39) V337M probably damaging Het
Dcbld2 A G 16: 58,271,186 (GRCm39) N321S probably benign Het
Enpep C T 3: 129,077,516 (GRCm39) probably null Het
Fat1 T C 8: 45,404,929 (GRCm39) L560P probably damaging Het
Fdxr T C 11: 115,166,915 (GRCm39) H58R possibly damaging Het
Filip1 G T 9: 79,767,373 (GRCm39) P147T probably damaging Het
Fras1 G A 5: 96,703,190 (GRCm39) E318K possibly damaging Het
Grk2 T C 19: 4,341,614 (GRCm39) probably null Het
Gvin-ps6 A T 7: 106,021,986 (GRCm39) C339S unknown Het
Havcr1 T C 11: 46,643,416 (GRCm39) I112T possibly damaging Het
Hjurp G A 1: 88,205,090 (GRCm39) probably benign Het
Ildr2 G A 1: 166,131,133 (GRCm39) V330I probably damaging Het
Ino80d T C 1: 63,097,115 (GRCm39) probably benign Het
Iqsec1 A G 6: 90,647,385 (GRCm39) probably benign Het
Irf2bpl C T 12: 86,928,417 (GRCm39) W752* probably null Het
Kdr T A 5: 76,102,494 (GRCm39) H1211L probably benign Het
Klri2 A G 6: 129,709,106 (GRCm39) *249R probably null Het
Ktn1 A T 14: 47,961,460 (GRCm39) K1054* probably null Het
Lactb2 A G 1: 13,720,984 (GRCm39) S83P possibly damaging Het
Lrrc3b A T 14: 15,358,560 (GRCm38) C15* probably null Het
Mrs2 T C 13: 25,177,078 (GRCm39) I430V probably benign Het
Nbas C T 12: 13,381,096 (GRCm39) T696I probably damaging Het
Nsun6 T C 2: 15,034,898 (GRCm39) D240G probably damaging Het
Nup107 T C 10: 117,599,674 (GRCm39) E615G probably damaging Het
Or2a25 A T 6: 42,888,872 (GRCm39) R138S probably benign Het
Or3a1d T A 11: 74,237,760 (GRCm39) I217F probably damaging Het
Or4k77 A T 2: 111,199,498 (GRCm39) I174L probably benign Het
Or5ac23 A G 16: 59,149,585 (GRCm39) C96R possibly damaging Het
Pabpc1l G A 2: 163,877,192 (GRCm39) V256M probably benign Het
Sf3b2 C T 19: 5,324,852 (GRCm39) D845N probably damaging Het
Sik1 T C 17: 32,067,958 (GRCm39) D409G probably benign Het
Slc22a22 A T 15: 57,113,131 (GRCm39) D369E possibly damaging Het
Smg1 T A 7: 117,767,523 (GRCm39) probably benign Het
Snap29 C A 16: 17,224,067 (GRCm39) D27E probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Sorcs3 A G 19: 48,592,333 (GRCm39) I333V probably benign Het
Spag7 A G 11: 70,555,622 (GRCm39) M105T probably damaging Het
Srgap3 A T 6: 112,748,432 (GRCm39) S407T probably damaging Het
Supt6 T C 11: 78,113,983 (GRCm39) N854S probably benign Het
Syne2 T C 12: 75,980,619 (GRCm39) S1460P probably damaging Het
Taok3 C T 5: 117,344,752 (GRCm39) Q160* probably null Het
Tchhl1 C A 3: 93,376,884 (GRCm39) A27E probably damaging Het
Tet1 T C 10: 62,714,178 (GRCm39) D539G probably damaging Het
Tut1 T C 19: 8,940,137 (GRCm39) F374L probably damaging Het
Unc5c C T 3: 141,533,283 (GRCm39) P770S probably benign Het
Vmn2r101 T A 17: 19,810,394 (GRCm39) N393K probably benign Het
Vmn2r94 T A 17: 18,477,556 (GRCm39) H285L probably benign Het
Wdr62 G A 7: 29,941,583 (GRCm39) S700L possibly damaging Het
Wscd1 A G 11: 71,679,549 (GRCm39) D474G probably damaging Het
Zcchc7 A G 4: 44,762,190 (GRCm39) N106S probably damaging Het
Zfp345 G T 2: 150,313,983 (GRCm39) T518N possibly damaging Het
Zfp648 A T 1: 154,080,413 (GRCm39) S191C possibly damaging Het
Zkscan8 C T 13: 21,710,844 (GRCm39) E89K probably damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 69,935,989 (GRCm39) splice site probably benign
IGL00959:Myo3b APN 2 70,144,636 (GRCm39) missense probably damaging 1.00
IGL01069:Myo3b APN 2 70,075,735 (GRCm39) missense probably benign 0.22
IGL01116:Myo3b APN 2 70,119,730 (GRCm39) missense probably damaging 1.00
IGL02097:Myo3b APN 2 70,069,173 (GRCm39) missense probably damaging 1.00
IGL02220:Myo3b APN 2 70,119,923 (GRCm39) splice site probably benign
IGL02553:Myo3b APN 2 69,925,568 (GRCm39) missense probably benign 0.00
IGL02557:Myo3b APN 2 70,085,663 (GRCm39) missense probably benign 0.16
IGL02648:Myo3b APN 2 69,935,716 (GRCm39) splice site probably benign
IGL02902:Myo3b APN 2 70,119,745 (GRCm39) missense probably benign 0.36
IGL02981:Myo3b APN 2 69,938,969 (GRCm39) missense probably damaging 1.00
IGL03030:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03031:Myo3b APN 2 70,085,721 (GRCm39) missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03078:Myo3b APN 2 70,117,335 (GRCm39) missense probably damaging 1.00
IGL03224:Myo3b APN 2 70,180,283 (GRCm39) missense probably benign
IGL03329:Myo3b APN 2 70,084,803 (GRCm39) missense probably damaging 1.00
R0079:Myo3b UTSW 2 69,925,502 (GRCm39) missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70,047,510 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0313:Myo3b UTSW 2 70,179,303 (GRCm39) nonsense probably null
R0331:Myo3b UTSW 2 69,925,605 (GRCm39) missense probably damaging 1.00
R0442:Myo3b UTSW 2 70,069,305 (GRCm39) critical splice donor site probably null
R0964:Myo3b UTSW 2 70,257,193 (GRCm39) missense probably damaging 1.00
R1217:Myo3b UTSW 2 70,161,224 (GRCm39) missense probably benign 0.02
R1429:Myo3b UTSW 2 70,083,351 (GRCm39) missense probably damaging 0.97
R1460:Myo3b UTSW 2 70,062,798 (GRCm39) missense probably benign 0.31
R1617:Myo3b UTSW 2 70,111,562 (GRCm39) missense probably benign 0.00
R1628:Myo3b UTSW 2 70,117,306 (GRCm39) missense probably benign 0.01
R1708:Myo3b UTSW 2 70,075,729 (GRCm39) nonsense probably null
R1940:Myo3b UTSW 2 70,088,419 (GRCm39) missense probably benign 0.01
R2407:Myo3b UTSW 2 70,085,597 (GRCm39) missense probably damaging 1.00
R3081:Myo3b UTSW 2 70,086,927 (GRCm39) splice site probably benign
R3687:Myo3b UTSW 2 70,075,658 (GRCm39) missense probably benign
R3745:Myo3b UTSW 2 70,064,829 (GRCm39) splice site probably benign
R4011:Myo3b UTSW 2 69,926,720 (GRCm39) missense probably benign 0.15
R4074:Myo3b UTSW 2 70,119,808 (GRCm39) missense probably damaging 1.00
R4419:Myo3b UTSW 2 69,926,706 (GRCm39) missense probably damaging 1.00
R4496:Myo3b UTSW 2 70,084,748 (GRCm39) missense probably benign
R4539:Myo3b UTSW 2 69,869,491 (GRCm39) start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70,069,186 (GRCm39) missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R4807:Myo3b UTSW 2 69,936,056 (GRCm39) missense probably damaging 1.00
R4849:Myo3b UTSW 2 70,075,253 (GRCm39) missense probably damaging 0.98
R4997:Myo3b UTSW 2 70,088,427 (GRCm39) missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70,088,412 (GRCm39) missense probably damaging 0.99
R5070:Myo3b UTSW 2 70,083,456 (GRCm39) missense probably damaging 1.00
R5072:Myo3b UTSW 2 69,925,593 (GRCm39) missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70,088,374 (GRCm39) missense probably benign 0.01
R5103:Myo3b UTSW 2 69,926,747 (GRCm39) missense probably benign 0.08
R5109:Myo3b UTSW 2 69,925,637 (GRCm39) missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70,257,232 (GRCm39) missense probably damaging 0.97
R5396:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R5400:Myo3b UTSW 2 69,935,724 (GRCm39) missense probably damaging 1.00
R5468:Myo3b UTSW 2 70,064,785 (GRCm39) missense probably benign 0.00
R5620:Myo3b UTSW 2 70,069,254 (GRCm39) missense probably benign 0.04
R5646:Myo3b UTSW 2 70,144,774 (GRCm39) missense probably damaging 0.97
R5729:Myo3b UTSW 2 69,936,083 (GRCm39) missense probably damaging 1.00
R5943:Myo3b UTSW 2 70,117,285 (GRCm39) missense probably benign 0.03
R5971:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70,069,113 (GRCm39) missense probably benign 0.00
R6138:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70,075,754 (GRCm39) critical splice donor site probably null
R6177:Myo3b UTSW 2 70,143,707 (GRCm39) missense probably benign 0.00
R6421:Myo3b UTSW 2 70,143,700 (GRCm39) missense probably benign 0.02
R6478:Myo3b UTSW 2 70,179,304 (GRCm39) missense probably benign
R6606:Myo3b UTSW 2 70,062,829 (GRCm39) missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70,119,856 (GRCm39) missense probably damaging 1.00
R6982:Myo3b UTSW 2 70,256,409 (GRCm39) missense probably benign 0.02
R6997:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R7032:Myo3b UTSW 2 69,925,608 (GRCm39) missense probably damaging 0.98
R7038:Myo3b UTSW 2 69,925,552 (GRCm39) missense probably benign 0.00
R7062:Myo3b UTSW 2 70,047,501 (GRCm39) missense probably benign 0.00
R7537:Myo3b UTSW 2 70,047,513 (GRCm39) missense probably benign 0.01
R7861:Myo3b UTSW 2 69,939,032 (GRCm39) missense probably damaging 1.00
R7955:Myo3b UTSW 2 69,925,623 (GRCm39) missense probably benign 0.37
R7977:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R7978:Myo3b UTSW 2 70,083,458 (GRCm39) missense probably damaging 1.00
R7987:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R8803:Myo3b UTSW 2 70,083,338 (GRCm39) missense probably benign
R8843:Myo3b UTSW 2 70,088,325 (GRCm39) missense probably damaging 1.00
R8896:Myo3b UTSW 2 70,069,160 (GRCm39) missense probably damaging 1.00
R8904:Myo3b UTSW 2 70,257,252 (GRCm39) missense probably benign 0.07
R8909:Myo3b UTSW 2 70,083,440 (GRCm39) missense probably damaging 1.00
R9031:Myo3b UTSW 2 70,082,094 (GRCm39) missense probably damaging 0.99
R9052:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
R9251:Myo3b UTSW 2 70,088,425 (GRCm39) nonsense probably null
R9268:Myo3b UTSW 2 70,257,305 (GRCm39) makesense probably null
R9334:Myo3b UTSW 2 70,047,360 (GRCm39) missense probably damaging 1.00
R9377:Myo3b UTSW 2 70,069,242 (GRCm39) missense possibly damaging 0.78
R9457:Myo3b UTSW 2 69,925,553 (GRCm39) missense probably benign 0.01
R9520:Myo3b UTSW 2 70,062,753 (GRCm39) missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70,075,648 (GRCm39) missense probably benign 0.43
R9671:Myo3b UTSW 2 70,086,908 (GRCm39) missense probably damaging 1.00
R9790:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
R9791:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
U15987:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
X0065:Myo3b UTSW 2 70,088,313 (GRCm39) missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70,088,371 (GRCm39) missense probably benign 0.01
Z1177:Myo3b UTSW 2 69,926,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTTTACTATCCCATGTGTTTGTGA -3'
(R):5'- GTTCCCACTGATGCTCTAAACGATGA -3'

Sequencing Primer
(F):5'- CTTGTAGGGACCTTTCAAAACAG -3'
(R):5'- gggACGACTTGCCATATGTTTTTATC -3'
Posted On 2013-04-24