Incidental Mutation 'R0371:Olfr1283'
ID30457
Institutional Source Beutler Lab
Gene Symbol Olfr1283
Ensembl Gene ENSMUSG00000109322
Gene Nameolfactory receptor 1283
SynonymsGA_x6K02T2Q125-72420217-72421134, MOR248-19
MMRRC Submission 038577-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.546) question?
Stock #R0371 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111366790-111370063 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111369153 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 174 (I174L)
Ref Sequence ENSEMBL: ENSMUSP00000150510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082167] [ENSMUST00000090328] [ENSMUST00000204064] [ENSMUST00000216637]
Predicted Effect probably benign
Transcript: ENSMUST00000082167
AA Change: I174L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000080805
Gene: ENSMUSG00000109449
AA Change: I174L

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 3.8e-50 PFAM
Pfam:7tm_1 41 287 9.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090328
AA Change: I174L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000087800
Gene: ENSMUSG00000109322
AA Change: I174L

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 3.6e-49 PFAM
Pfam:7tm_1 41 287 3.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204064
AA Change: I174L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000145495
Gene: ENSMUSG00000109322
AA Change: I174L

DomainStartEndE-ValueType
Pfam:7tm_4 30 298 2.1e-39 PFAM
Pfam:7tm_1 40 286 7.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216637
AA Change: I174L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.6%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 G A 16: 4,288,047 R1068C probably benign Het
Afmid C T 11: 117,835,140 probably benign Het
Aqr A G 2: 114,157,604 V159A possibly damaging Het
Atp6v0d2 G C 4: 19,880,033 T288R possibly damaging Het
Btnl1 T C 17: 34,381,057 V178A probably damaging Het
Ccdc110 T A 8: 45,942,806 M578K possibly damaging Het
Ccdc38 G T 10: 93,562,812 E51* probably null Het
Cep290 T A 10: 100,518,564 probably benign Het
Cilp2 T C 8: 69,881,606 E914G probably damaging Het
Col6a2 T C 10: 76,614,473 N208S probably benign Het
Ctrb1 T A 8: 111,687,151 I194F probably benign Het
Cyp4a12a C G 4: 115,326,683 R229G probably damaging Het
Dach1 C T 14: 97,969,903 V337M probably damaging Het
Dcbld2 A G 16: 58,450,823 N321S probably benign Het
Enpep C T 3: 129,283,867 probably null Het
Fat1 T C 8: 44,951,892 L560P probably damaging Het
Fdxr T C 11: 115,276,089 H58R possibly damaging Het
Filip1 G T 9: 79,860,091 P147T probably damaging Het
Fras1 G A 5: 96,555,331 E318K possibly damaging Het
Gm4759 A T 7: 106,422,779 C339S unknown Het
Grk2 T C 19: 4,291,586 probably null Het
Havcr1 T C 11: 46,752,589 I112T possibly damaging Het
Hjurp G A 1: 88,277,368 probably benign Het
Ildr2 G A 1: 166,303,564 V330I probably damaging Het
Ino80d T C 1: 63,057,956 probably benign Het
Iqsec1 A G 6: 90,670,403 probably benign Het
Irf2bpl C T 12: 86,881,643 W752* probably null Het
Kdr T A 5: 75,941,834 H1211L probably benign Het
Klri2 A G 6: 129,732,143 *249R probably null Het
Ktn1 A T 14: 47,724,003 K1054* probably null Het
Lactb2 A G 1: 13,650,760 S83P possibly damaging Het
Lrrc3b A T 14: 15,358,560 C15* probably null Het
Mrs2 T C 13: 24,993,095 I430V probably benign Het
Myo3b C T 2: 70,252,960 probably benign Het
Nbas C T 12: 13,331,095 T696I probably damaging Het
Nsun6 T C 2: 15,030,087 D240G probably damaging Het
Nup107 T C 10: 117,763,769 E615G probably damaging Het
Olfr205 A G 16: 59,329,222 C96R possibly damaging Het
Olfr411 T A 11: 74,346,934 I217F probably damaging Het
Olfr447 A T 6: 42,911,938 R138S probably benign Het
Pabpc1l G A 2: 164,035,272 V256M probably benign Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Sik1 T C 17: 31,848,984 D409G probably benign Het
Slc22a22 A T 15: 57,249,735 D369E possibly damaging Het
Smg1 T A 7: 118,168,300 probably benign Het
Snap29 C A 16: 17,406,203 D27E probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Sorcs3 A G 19: 48,603,894 I333V probably benign Het
Spag7 A G 11: 70,664,796 M105T probably damaging Het
Srgap3 A T 6: 112,771,471 S407T probably damaging Het
Supt6 T C 11: 78,223,157 N854S probably benign Het
Syne2 T C 12: 75,933,845 S1460P probably damaging Het
Taok3 C T 5: 117,206,687 Q160* probably null Het
Tchhl1 C A 3: 93,469,577 A27E probably damaging Het
Tet1 T C 10: 62,878,399 D539G probably damaging Het
Tut1 T C 19: 8,962,773 F374L probably damaging Het
Unc5c C T 3: 141,827,522 P770S probably benign Het
Vmn2r101 T A 17: 19,590,132 N393K probably benign Het
Vmn2r94 T A 17: 18,257,294 H285L probably benign Het
Wdr62 G A 7: 30,242,158 S700L possibly damaging Het
Wscd1 A G 11: 71,788,723 D474G probably damaging Het
Zcchc7 A G 4: 44,762,190 N106S probably damaging Het
Zfp345 G T 2: 150,472,063 T518N possibly damaging Het
Zfp648 A T 1: 154,204,667 S191C possibly damaging Het
Zkscan8 C T 13: 21,526,674 E89K probably damaging Het
Other mutations in Olfr1283
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02337:Olfr1283 APN 2 111369151 missense probably benign 0.22
IGL02716:Olfr1283 APN 2 111368781 missense probably benign 0.04
R0090:Olfr1283 UTSW 2 111369294 missense probably damaging 1.00
R0141:Olfr1283 UTSW 2 111369490 missense probably damaging 1.00
R0417:Olfr1283 UTSW 2 111369105 missense possibly damaging 0.57
R1673:Olfr1283 UTSW 2 111369207 missense probably benign 0.11
R1970:Olfr1283 UTSW 2 111369076 missense probably benign 0.19
R2069:Olfr1283 UTSW 2 111369095 missense probably benign 0.43
R3897:Olfr1283 UTSW 2 111368761 missense possibly damaging 0.87
R4408:Olfr1283 UTSW 2 111369280 missense possibly damaging 0.63
R5397:Olfr1283 UTSW 2 111368940 missense probably benign 0.00
R5888:Olfr1283 UTSW 2 111368743 missense probably benign
R6281:Olfr1283 UTSW 2 111369549 makesense probably null
R6323:Olfr1283 UTSW 2 111368701 missense possibly damaging 0.94
R6801:Olfr1283 UTSW 2 111369049 missense probably benign 0.22
R7219:Olfr1283 UTSW 2 111369537 missense probably benign
R7271:Olfr1283 UTSW 2 111369348 missense probably damaging 1.00
R7438:Olfr1283 UTSW 2 111369362 missense probably damaging 1.00
R7761:Olfr1283 UTSW 2 111368793 missense probably benign 0.00
R7792:Olfr1283 UTSW 2 111369403 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTAATGGCTGTGGTAGGCAACCTC -3'
(R):5'- ACTTGTCAACCCAGGTGATGCTAAC -3'

Sequencing Primer
(F):5'- CATGAGCCAGATCCTCTGTGTG -3'
(R):5'- ACCACTATGATATGGGATGTGC -3'
Posted On2013-04-24