Incidental Mutation 'R0371:Unc5c'
ID30462
Institutional Source Beutler Lab
Gene Symbol Unc5c
Ensembl Gene ENSMUSG00000059921
Gene Nameunc-5 netrin receptor C
SynonymsB130051O18Rik, Unc5h3
MMRRC Submission 038577-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0371 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location141465216-141834924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 141827522 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 770 (P770S)
Ref Sequence ENSEMBL: ENSMUSP00000117487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075282] [ENSMUST00000106236] [ENSMUST00000130636] [ENSMUST00000142762]
Predicted Effect probably benign
Transcript: ENSMUST00000075282
AA Change: P844S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000074758
Gene: ENSMUSG00000059921
AA Change: P844S

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106236
AA Change: P825S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101843
Gene: ENSMUSG00000059921
AA Change: P825S

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 377 399 N/A INTRINSIC
ZU5 528 631 6.92e-63 SMART
low complexity region 676 685 N/A INTRINSIC
DEATH 838 929 6.68e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130636
AA Change: P770S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117487
Gene: ENSMUSG00000059921
AA Change: P770S

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IGc2 105 172 2.72e-5 SMART
TSP1 189 240 8.54e-13 SMART
TSP1 245 294 1.18e-6 SMART
transmembrane domain 322 344 N/A INTRINSIC
ZU5 473 576 6.92e-63 SMART
low complexity region 621 630 N/A INTRINSIC
DEATH 783 874 6.68e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142762
AA Change: P844S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000118212
Gene: ENSMUSG00000059921
AA Change: P844S

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Meta Mutation Damage Score 0.0818 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.6%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the UNC-5 family of netrin receptors. Netrins are secreted proteins that direct axon extension and cell migration during neural development. They are bifunctional proteins that act as attractants for some cell types and as repellents for others, and these opposite actions are thought to be mediated by two classes of receptors. The UNC-5 family of receptors mediate the repellent response to netrin; they are transmembrane proteins containing 2 immunoglobulin (Ig)-like domains and 2 type I thrombospondin motifs in the extracellular region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants exhibit ataxia, and reduced size early in life. Mutants exhibit cerebellar defects including reduced size and ectopic cerebellar cells in the midbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 G A 16: 4,288,047 R1068C probably benign Het
Afmid C T 11: 117,835,140 probably benign Het
Aqr A G 2: 114,157,604 V159A possibly damaging Het
Atp6v0d2 G C 4: 19,880,033 T288R possibly damaging Het
Btnl1 T C 17: 34,381,057 V178A probably damaging Het
Ccdc110 T A 8: 45,942,806 M578K possibly damaging Het
Ccdc38 G T 10: 93,562,812 E51* probably null Het
Cep290 T A 10: 100,518,564 probably benign Het
Cilp2 T C 8: 69,881,606 E914G probably damaging Het
Col6a2 T C 10: 76,614,473 N208S probably benign Het
Ctrb1 T A 8: 111,687,151 I194F probably benign Het
Cyp4a12a C G 4: 115,326,683 R229G probably damaging Het
Dach1 C T 14: 97,969,903 V337M probably damaging Het
Dcbld2 A G 16: 58,450,823 N321S probably benign Het
Enpep C T 3: 129,283,867 probably null Het
Fat1 T C 8: 44,951,892 L560P probably damaging Het
Fdxr T C 11: 115,276,089 H58R possibly damaging Het
Filip1 G T 9: 79,860,091 P147T probably damaging Het
Fras1 G A 5: 96,555,331 E318K possibly damaging Het
Gm4759 A T 7: 106,422,779 C339S unknown Het
Grk2 T C 19: 4,291,586 probably null Het
Havcr1 T C 11: 46,752,589 I112T possibly damaging Het
Hjurp G A 1: 88,277,368 probably benign Het
Ildr2 G A 1: 166,303,564 V330I probably damaging Het
Ino80d T C 1: 63,057,956 probably benign Het
Iqsec1 A G 6: 90,670,403 probably benign Het
Irf2bpl C T 12: 86,881,643 W752* probably null Het
Kdr T A 5: 75,941,834 H1211L probably benign Het
Klri2 A G 6: 129,732,143 *249R probably null Het
Ktn1 A T 14: 47,724,003 K1054* probably null Het
Lactb2 A G 1: 13,650,760 S83P possibly damaging Het
Lrrc3b A T 14: 15,358,560 C15* probably null Het
Mrs2 T C 13: 24,993,095 I430V probably benign Het
Myo3b C T 2: 70,252,960 probably benign Het
Nbas C T 12: 13,331,095 T696I probably damaging Het
Nsun6 T C 2: 15,030,087 D240G probably damaging Het
Nup107 T C 10: 117,763,769 E615G probably damaging Het
Olfr1283 A T 2: 111,369,153 I174L probably benign Het
Olfr205 A G 16: 59,329,222 C96R possibly damaging Het
Olfr411 T A 11: 74,346,934 I217F probably damaging Het
Olfr447 A T 6: 42,911,938 R138S probably benign Het
Pabpc1l G A 2: 164,035,272 V256M probably benign Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Sik1 T C 17: 31,848,984 D409G probably benign Het
Slc22a22 A T 15: 57,249,735 D369E possibly damaging Het
Smg1 T A 7: 118,168,300 probably benign Het
Snap29 C A 16: 17,406,203 D27E probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Sorcs3 A G 19: 48,603,894 I333V probably benign Het
Spag7 A G 11: 70,664,796 M105T probably damaging Het
Srgap3 A T 6: 112,771,471 S407T probably damaging Het
Supt6 T C 11: 78,223,157 N854S probably benign Het
Syne2 T C 12: 75,933,845 S1460P probably damaging Het
Taok3 C T 5: 117,206,687 Q160* probably null Het
Tchhl1 C A 3: 93,469,577 A27E probably damaging Het
Tet1 T C 10: 62,878,399 D539G probably damaging Het
Tut1 T C 19: 8,962,773 F374L probably damaging Het
Vmn2r101 T A 17: 19,590,132 N393K probably benign Het
Vmn2r94 T A 17: 18,257,294 H285L probably benign Het
Wdr62 G A 7: 30,242,158 S700L possibly damaging Het
Wscd1 A G 11: 71,788,723 D474G probably damaging Het
Zcchc7 A G 4: 44,762,190 N106S probably damaging Het
Zfp345 G T 2: 150,472,063 T518N possibly damaging Het
Zfp648 A T 1: 154,204,667 S191C possibly damaging Het
Zkscan8 C T 13: 21,526,674 E89K probably damaging Het
Other mutations in Unc5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Unc5c APN 3 141788940 missense probably damaging 0.99
IGL01089:Unc5c APN 3 141818202 splice site probably benign
IGL01478:Unc5c APN 3 141828451 missense probably damaging 1.00
IGL02083:Unc5c APN 3 141714647 missense probably damaging 0.99
IGL02269:Unc5c APN 3 141788982 missense probably damaging 1.00
IGL02565:Unc5c APN 3 141803919 missense probably damaging 1.00
IGL02973:Unc5c APN 3 141788890 missense probably benign 0.12
R0179:Unc5c UTSW 3 141818067 nonsense probably null
R0309:Unc5c UTSW 3 141733933 missense probably benign 0.01
R0603:Unc5c UTSW 3 141771102 missense probably damaging 1.00
R0904:Unc5c UTSW 3 141803840 missense probably benign 0.08
R0907:Unc5c UTSW 3 141789033 missense probably damaging 0.99
R1300:Unc5c UTSW 3 141828543 missense possibly damaging 0.94
R1491:Unc5c UTSW 3 141789822 missense probably damaging 1.00
R1494:Unc5c UTSW 3 141827549 missense possibly damaging 0.93
R1674:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1676:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1726:Unc5c UTSW 3 141818103 missense probably damaging 1.00
R1750:Unc5c UTSW 3 141827517 missense possibly damaging 0.89
R1815:Unc5c UTSW 3 141757757 missense probably damaging 1.00
R2381:Unc5c UTSW 3 141678155 missense probably damaging 1.00
R2394:Unc5c UTSW 3 141678131 missense probably damaging 1.00
R2945:Unc5c UTSW 3 141789974 missense probably damaging 0.97
R4284:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4285:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4287:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4681:Unc5c UTSW 3 141768613 critical splice donor site probably null
R4736:Unc5c UTSW 3 141816931 missense probably benign 0.00
R4740:Unc5c UTSW 3 141816931 missense probably benign 0.00
R4774:Unc5c UTSW 3 141828517 missense probably damaging 1.00
R4862:Unc5c UTSW 3 141789773 missense probably damaging 1.00
R4905:Unc5c UTSW 3 141801310 missense probably benign 0.19
R4921:Unc5c UTSW 3 141788966 missense probably damaging 1.00
R5150:Unc5c UTSW 3 141757793 missense probably damaging 1.00
R5559:Unc5c UTSW 3 141803787 missense probably damaging 1.00
R5562:Unc5c UTSW 3 141768530 missense probably damaging 1.00
R5643:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5644:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5775:Unc5c UTSW 3 141828520 missense probably damaging 1.00
R5912:Unc5c UTSW 3 141789006 missense probably damaging 1.00
R6154:Unc5c UTSW 3 141678153 missense probably damaging 0.97
R6547:Unc5c UTSW 3 141790019 missense probably benign 0.16
R6558:Unc5c UTSW 3 141789729 missense probably damaging 0.98
R7104:Unc5c UTSW 3 141733904 missense probably damaging 1.00
R7113:Unc5c UTSW 3 141801293 missense probably benign 0.00
R7282:Unc5c UTSW 3 141677990 missense probably damaging 0.98
R7317:Unc5c UTSW 3 141789942 missense probably benign 0.00
R7787:Unc5c UTSW 3 141768552 missense probably damaging 1.00
R7873:Unc5c UTSW 3 141827549 missense probably benign 0.04
R7896:Unc5c UTSW 3 141771161 missense possibly damaging 0.73
R7956:Unc5c UTSW 3 141827549 missense probably benign 0.04
R7979:Unc5c UTSW 3 141771161 missense possibly damaging 0.73
X0018:Unc5c UTSW 3 141714739 missense probably damaging 1.00
X0065:Unc5c UTSW 3 141827661 missense probably damaging 1.00
Z1088:Unc5c UTSW 3 141733900 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGTTGAGAACTGCGATCTTGGAG -3'
(R):5'- AGGTCTAGAAGCCTGGACACACTC -3'

Sequencing Primer
(F):5'- CTAGGAACTCTGAACATGGGCTATAC -3'
(R):5'- ACACTCACCTGTCCAGGTTG -3'
Posted On2013-04-24