Incidental Mutation 'R0371:Kdr'
ID30466
Institutional Source Beutler Lab
Gene Symbol Kdr
Ensembl Gene ENSMUSG00000062960
Gene Namekinase insert domain protein receptor
SynonymsFlk1, vascular endothelial growth factor receptor- 2, VEGF receptor-2, VEGFR2, VEGFR-2, Flk-1
MMRRC Submission 038577-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0371 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location75932827-75978458 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75941834 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 1211 (H1211L)
Ref Sequence ENSEMBL: ENSMUSP00000109144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113516]
Predicted Effect probably benign
Transcript: ENSMUST00000113516
AA Change: H1211L

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000109144
Gene: ENSMUSG00000062960
AA Change: H1211L

DomainStartEndE-ValueType
IG 38 121 2.43e-2 SMART
IG_like 137 220 5.91e1 SMART
IG 233 327 2.64e-12 SMART
IG 339 420 1.2e-6 SMART
IG 432 546 2.14e0 SMART
IG 554 657 2.79e-2 SMART
IGc2 677 742 8.42e-20 SMART
TyrKc 832 1158 7.07e-138 SMART
low complexity region 1310 1315 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.6%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vascular endothelial growth factor (VEGF) is a major growth factor for endothelial cells. This gene encodes one of the two receptors of the VEGF. This receptor, known as kinase insert domain receptor, is a type III receptor tyrosine kinase. It functions as the main mediator of VEGF-induced endothelial proliferation, survival, migration, tubular morphogenesis and sprouting. The signalling and trafficking of this receptor are regulated by multiple factors, including Rab GTPase, P2Y purine nucleotide receptor, integrin alphaVbeta3, T-cell protein tyrosine phosphatase, etc.. Mutations of this gene are implicated in infantile capillary hemangiomas. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous mice die at early embryonic stages due to failure of blood vessel formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 G A 16: 4,288,047 R1068C probably benign Het
Afmid C T 11: 117,835,140 probably benign Het
Aqr A G 2: 114,157,604 V159A possibly damaging Het
Atp6v0d2 G C 4: 19,880,033 T288R possibly damaging Het
Btnl1 T C 17: 34,381,057 V178A probably damaging Het
Ccdc110 T A 8: 45,942,806 M578K possibly damaging Het
Ccdc38 G T 10: 93,562,812 E51* probably null Het
Cep290 T A 10: 100,518,564 probably benign Het
Cilp2 T C 8: 69,881,606 E914G probably damaging Het
Col6a2 T C 10: 76,614,473 N208S probably benign Het
Ctrb1 T A 8: 111,687,151 I194F probably benign Het
Cyp4a12a C G 4: 115,326,683 R229G probably damaging Het
Dach1 C T 14: 97,969,903 V337M probably damaging Het
Dcbld2 A G 16: 58,450,823 N321S probably benign Het
Enpep C T 3: 129,283,867 probably null Het
Fat1 T C 8: 44,951,892 L560P probably damaging Het
Fdxr T C 11: 115,276,089 H58R possibly damaging Het
Filip1 G T 9: 79,860,091 P147T probably damaging Het
Fras1 G A 5: 96,555,331 E318K possibly damaging Het
Gm4759 A T 7: 106,422,779 C339S unknown Het
Grk2 T C 19: 4,291,586 probably null Het
Havcr1 T C 11: 46,752,589 I112T possibly damaging Het
Hjurp G A 1: 88,277,368 probably benign Het
Ildr2 G A 1: 166,303,564 V330I probably damaging Het
Ino80d T C 1: 63,057,956 probably benign Het
Iqsec1 A G 6: 90,670,403 probably benign Het
Irf2bpl C T 12: 86,881,643 W752* probably null Het
Klri2 A G 6: 129,732,143 *249R probably null Het
Ktn1 A T 14: 47,724,003 K1054* probably null Het
Lactb2 A G 1: 13,650,760 S83P possibly damaging Het
Lrrc3b A T 14: 15,358,560 C15* probably null Het
Mrs2 T C 13: 24,993,095 I430V probably benign Het
Myo3b C T 2: 70,252,960 probably benign Het
Nbas C T 12: 13,331,095 T696I probably damaging Het
Nsun6 T C 2: 15,030,087 D240G probably damaging Het
Nup107 T C 10: 117,763,769 E615G probably damaging Het
Olfr1283 A T 2: 111,369,153 I174L probably benign Het
Olfr205 A G 16: 59,329,222 C96R possibly damaging Het
Olfr411 T A 11: 74,346,934 I217F probably damaging Het
Olfr447 A T 6: 42,911,938 R138S probably benign Het
Pabpc1l G A 2: 164,035,272 V256M probably benign Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Sik1 T C 17: 31,848,984 D409G probably benign Het
Slc22a22 A T 15: 57,249,735 D369E possibly damaging Het
Smg1 T A 7: 118,168,300 probably benign Het
Snap29 C A 16: 17,406,203 D27E probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Sorcs3 A G 19: 48,603,894 I333V probably benign Het
Spag7 A G 11: 70,664,796 M105T probably damaging Het
Srgap3 A T 6: 112,771,471 S407T probably damaging Het
Supt6 T C 11: 78,223,157 N854S probably benign Het
Syne2 T C 12: 75,933,845 S1460P probably damaging Het
Taok3 C T 5: 117,206,687 Q160* probably null Het
Tchhl1 C A 3: 93,469,577 A27E probably damaging Het
Tet1 T C 10: 62,878,399 D539G probably damaging Het
Tut1 T C 19: 8,962,773 F374L probably damaging Het
Unc5c C T 3: 141,827,522 P770S probably benign Het
Vmn2r101 T A 17: 19,590,132 N393K probably benign Het
Vmn2r94 T A 17: 18,257,294 H285L probably benign Het
Wdr62 G A 7: 30,242,158 S700L possibly damaging Het
Wscd1 A G 11: 71,788,723 D474G probably damaging Het
Zcchc7 A G 4: 44,762,190 N106S probably damaging Het
Zfp345 G T 2: 150,472,063 T518N possibly damaging Het
Zfp648 A T 1: 154,204,667 S191C possibly damaging Het
Zkscan8 C T 13: 21,526,674 E89K probably damaging Het
Other mutations in Kdr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Kdr APN 5 75968750 missense probably damaging 1.00
IGL01094:Kdr APN 5 75961760 missense probably benign 0.00
IGL01310:Kdr APN 5 75949601 missense probably damaging 1.00
IGL01689:Kdr APN 5 75936840 missense probably benign 0.01
IGL01986:Kdr APN 5 75952859 missense probably benign 0.18
IGL02065:Kdr APN 5 75961853 splice site probably benign
IGL02200:Kdr APN 5 75950102 splice site probably benign
IGL02272:Kdr APN 5 75961840 missense probably benign
IGL02426:Kdr APN 5 75974466 missense probably benign 0.00
IGL02483:Kdr APN 5 75936294 critical splice donor site probably null
IGL02543:Kdr APN 5 75964947 splice site probably benign
IGL02590:Kdr APN 5 75936323 missense probably benign 0.00
IGL03204:Kdr APN 5 75972382 missense possibly damaging 0.96
IGL03228:Kdr APN 5 75957048 missense probably damaging 0.97
IGL03265:Kdr APN 5 75960773 missense probably damaging 1.00
engelein UTSW 5 75952889 missense probably damaging 1.00
PIT4131001:Kdr UTSW 5 75941971 splice site probably benign
PIT4519001:Kdr UTSW 5 75936896 missense possibly damaging 0.86
R0133:Kdr UTSW 5 75951838 missense probably damaging 1.00
R0197:Kdr UTSW 5 75968422 missense possibly damaging 0.82
R0282:Kdr UTSW 5 75950100 splice site probably benign
R0309:Kdr UTSW 5 75946927 splice site probably benign
R0396:Kdr UTSW 5 75960728 missense possibly damaging 0.65
R0498:Kdr UTSW 5 75959138 missense probably benign 0.00
R0932:Kdr UTSW 5 75968805 missense probably benign 0.02
R1077:Kdr UTSW 5 75956231 missense probably damaging 1.00
R1183:Kdr UTSW 5 75946851 missense probably damaging 1.00
R1713:Kdr UTSW 5 75968467 missense probably benign 0.03
R1853:Kdr UTSW 5 75952905 missense possibly damaging 0.67
R1854:Kdr UTSW 5 75952905 missense possibly damaging 0.67
R2142:Kdr UTSW 5 75968423 missense possibly damaging 0.56
R2238:Kdr UTSW 5 75949519 missense possibly damaging 0.78
R2891:Kdr UTSW 5 75946836 missense probably damaging 1.00
R2893:Kdr UTSW 5 75946836 missense probably damaging 1.00
R2894:Kdr UTSW 5 75946836 missense probably damaging 1.00
R2903:Kdr UTSW 5 75966409 missense probably damaging 1.00
R2904:Kdr UTSW 5 75966409 missense probably damaging 1.00
R3155:Kdr UTSW 5 75968405 missense probably benign 0.02
R3939:Kdr UTSW 5 75972429 nonsense probably null
R4051:Kdr UTSW 5 75968408 missense probably benign
R4151:Kdr UTSW 5 75957101 missense possibly damaging 0.94
R4433:Kdr UTSW 5 75943925 missense possibly damaging 0.61
R4687:Kdr UTSW 5 75968792 missense possibly damaging 0.81
R4691:Kdr UTSW 5 75944599 missense possibly damaging 0.79
R5185:Kdr UTSW 5 75952417 splice site probably null
R5544:Kdr UTSW 5 75960743 nonsense probably null
R6083:Kdr UTSW 5 75944366 missense probably damaging 1.00
R6477:Kdr UTSW 5 75968841 missense probably benign 0.02
R6568:Kdr UTSW 5 75961774 missense probably benign 0.01
R6647:Kdr UTSW 5 75952889 missense probably damaging 1.00
R6827:Kdr UTSW 5 75944545 missense probably damaging 1.00
R6887:Kdr UTSW 5 75968451 missense probably benign 0.00
R6929:Kdr UTSW 5 75978104 missense probably benign 0.16
R6993:Kdr UTSW 5 75972411 missense probably benign
R7022:Kdr UTSW 5 75972260 nonsense probably null
R7050:Kdr UTSW 5 75950120 missense probably damaging 1.00
R7099:Kdr UTSW 5 75944333 missense probably damaging 0.98
R7274:Kdr UTSW 5 75964700 missense probably benign 0.00
R7310:Kdr UTSW 5 75944325 missense probably damaging 0.99
R7565:Kdr UTSW 5 75948843 missense probably damaging 0.97
X0024:Kdr UTSW 5 75974406 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCCCTCTGAATGTCAGAACTCC -3'
(R):5'- CTGTCAAGCCTCTTCCAAGACAGTC -3'

Sequencing Primer
(F):5'- CCTCTGAATGTCAGAACTCCAGTTAG -3'
(R):5'- TGTTCAGATATGAAAGCAGCACAC -3'
Posted On2013-04-24