Incidental Mutation 'R0371:Srgap3'
ID 30471
Institutional Source Beutler Lab
Gene Symbol Srgap3
Ensembl Gene ENSMUSG00000030257
Gene Name SLIT-ROBO Rho GTPase activating protein 3
Synonyms Arhgap14, D130026O08Rik
MMRRC Submission 038577-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.246) question?
Stock # R0371 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 112694932-112924227 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 112748432 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 407 (S407T)
Ref Sequence ENSEMBL: ENSMUSP00000108794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088373] [ENSMUST00000113169] [ENSMUST00000131835]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000060215
Predicted Effect probably damaging
Transcript: ENSMUST00000088373
AA Change: S407T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085712
Gene: ENSMUSG00000030257
AA Change: S407T

DomainStartEndE-ValueType
FCH 22 120 3.81e-16 SMART
low complexity region 172 190 N/A INTRINSIC
coiled coil region 353 392 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
RhoGAP 517 691 7.43e-66 SMART
SH3 747 802 9.69e-15 SMART
coiled coil region 955 985 N/A INTRINSIC
low complexity region 1025 1038 N/A INTRINSIC
low complexity region 1053 1064 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113169
AA Change: S407T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108794
Gene: ENSMUSG00000030257
AA Change: S407T

DomainStartEndE-ValueType
FCH 22 120 3.81e-16 SMART
low complexity region 172 190 N/A INTRINSIC
coiled coil region 353 392 N/A INTRINSIC
Blast:RhoGAP 434 474 4e-11 BLAST
low complexity region 476 488 N/A INTRINSIC
RhoGAP 493 667 7.43e-66 SMART
SH3 723 778 9.69e-15 SMART
coiled coil region 931 961 N/A INTRINSIC
low complexity region 1001 1014 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131835
SMART Domains Protein: ENSMUSP00000130063
Gene: ENSMUSG00000030257

DomainStartEndE-ValueType
Blast:RhoGAP 1 33 2e-14 BLAST
transmembrane domain 69 91 N/A INTRINSIC
Meta Mutation Damage Score 0.0913 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.6%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction in spine density in the brain CA1 and cortical layers IV/V. Mice homozygous for a different knock-out allele exhibit a neurodevelopment disorder with schizophrenia-related intermediate phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 G A 16: 4,105,911 (GRCm39) R1068C probably benign Het
Afmid C T 11: 117,725,966 (GRCm39) probably benign Het
Aqr A G 2: 113,988,085 (GRCm39) V159A possibly damaging Het
Atp6v0d2 G C 4: 19,880,033 (GRCm39) T288R possibly damaging Het
Btnl1 T C 17: 34,600,031 (GRCm39) V178A probably damaging Het
Ccdc110 T A 8: 46,395,843 (GRCm39) M578K possibly damaging Het
Ccdc38 G T 10: 93,398,674 (GRCm39) E51* probably null Het
Cep290 T A 10: 100,354,426 (GRCm39) probably benign Het
Cilp2 T C 8: 70,334,256 (GRCm39) E914G probably damaging Het
Col6a2 T C 10: 76,450,307 (GRCm39) N208S probably benign Het
Ctrb1 T A 8: 112,413,783 (GRCm39) I194F probably benign Het
Cyp4a12a C G 4: 115,183,880 (GRCm39) R229G probably damaging Het
Dach1 C T 14: 98,207,339 (GRCm39) V337M probably damaging Het
Dcbld2 A G 16: 58,271,186 (GRCm39) N321S probably benign Het
Enpep C T 3: 129,077,516 (GRCm39) probably null Het
Fat1 T C 8: 45,404,929 (GRCm39) L560P probably damaging Het
Fdxr T C 11: 115,166,915 (GRCm39) H58R possibly damaging Het
Filip1 G T 9: 79,767,373 (GRCm39) P147T probably damaging Het
Fras1 G A 5: 96,703,190 (GRCm39) E318K possibly damaging Het
Grk2 T C 19: 4,341,614 (GRCm39) probably null Het
Gvin-ps6 A T 7: 106,021,986 (GRCm39) C339S unknown Het
Havcr1 T C 11: 46,643,416 (GRCm39) I112T possibly damaging Het
Hjurp G A 1: 88,205,090 (GRCm39) probably benign Het
Ildr2 G A 1: 166,131,133 (GRCm39) V330I probably damaging Het
Ino80d T C 1: 63,097,115 (GRCm39) probably benign Het
Iqsec1 A G 6: 90,647,385 (GRCm39) probably benign Het
Irf2bpl C T 12: 86,928,417 (GRCm39) W752* probably null Het
Kdr T A 5: 76,102,494 (GRCm39) H1211L probably benign Het
Klri2 A G 6: 129,709,106 (GRCm39) *249R probably null Het
Ktn1 A T 14: 47,961,460 (GRCm39) K1054* probably null Het
Lactb2 A G 1: 13,720,984 (GRCm39) S83P possibly damaging Het
Lrrc3b A T 14: 15,358,560 (GRCm38) C15* probably null Het
Mrs2 T C 13: 25,177,078 (GRCm39) I430V probably benign Het
Myo3b C T 2: 70,083,304 (GRCm39) probably benign Het
Nbas C T 12: 13,381,096 (GRCm39) T696I probably damaging Het
Nsun6 T C 2: 15,034,898 (GRCm39) D240G probably damaging Het
Nup107 T C 10: 117,599,674 (GRCm39) E615G probably damaging Het
Or2a25 A T 6: 42,888,872 (GRCm39) R138S probably benign Het
Or3a1d T A 11: 74,237,760 (GRCm39) I217F probably damaging Het
Or4k77 A T 2: 111,199,498 (GRCm39) I174L probably benign Het
Or5ac23 A G 16: 59,149,585 (GRCm39) C96R possibly damaging Het
Pabpc1l G A 2: 163,877,192 (GRCm39) V256M probably benign Het
Sf3b2 C T 19: 5,324,852 (GRCm39) D845N probably damaging Het
Sik1 T C 17: 32,067,958 (GRCm39) D409G probably benign Het
Slc22a22 A T 15: 57,113,131 (GRCm39) D369E possibly damaging Het
Smg1 T A 7: 117,767,523 (GRCm39) probably benign Het
Snap29 C A 16: 17,224,067 (GRCm39) D27E probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Sorcs3 A G 19: 48,592,333 (GRCm39) I333V probably benign Het
Spag7 A G 11: 70,555,622 (GRCm39) M105T probably damaging Het
Supt6 T C 11: 78,113,983 (GRCm39) N854S probably benign Het
Syne2 T C 12: 75,980,619 (GRCm39) S1460P probably damaging Het
Taok3 C T 5: 117,344,752 (GRCm39) Q160* probably null Het
Tchhl1 C A 3: 93,376,884 (GRCm39) A27E probably damaging Het
Tet1 T C 10: 62,714,178 (GRCm39) D539G probably damaging Het
Tut1 T C 19: 8,940,137 (GRCm39) F374L probably damaging Het
Unc5c C T 3: 141,533,283 (GRCm39) P770S probably benign Het
Vmn2r101 T A 17: 19,810,394 (GRCm39) N393K probably benign Het
Vmn2r94 T A 17: 18,477,556 (GRCm39) H285L probably benign Het
Wdr62 G A 7: 29,941,583 (GRCm39) S700L possibly damaging Het
Wscd1 A G 11: 71,679,549 (GRCm39) D474G probably damaging Het
Zcchc7 A G 4: 44,762,190 (GRCm39) N106S probably damaging Het
Zfp345 G T 2: 150,313,983 (GRCm39) T518N possibly damaging Het
Zfp648 A T 1: 154,080,413 (GRCm39) S191C possibly damaging Het
Zkscan8 C T 13: 21,710,844 (GRCm39) E89K probably damaging Het
Other mutations in Srgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Srgap3 APN 6 112,716,358 (GRCm39) missense probably damaging 0.98
IGL01325:Srgap3 APN 6 112,752,647 (GRCm39) missense probably damaging 1.00
IGL01608:Srgap3 APN 6 112,923,439 (GRCm39) missense probably benign 0.00
IGL01626:Srgap3 APN 6 112,750,609 (GRCm39) missense probably damaging 0.98
IGL01787:Srgap3 APN 6 112,699,983 (GRCm39) missense probably benign 0.00
IGL02698:Srgap3 APN 6 112,723,889 (GRCm39) missense probably damaging 0.98
IGL02805:Srgap3 APN 6 112,704,224 (GRCm39) missense probably damaging 0.99
IGL02813:Srgap3 APN 6 112,708,441 (GRCm39) missense probably damaging 1.00
IGL02876:Srgap3 APN 6 112,748,414 (GRCm39) missense probably damaging 1.00
IGL03264:Srgap3 APN 6 112,793,636 (GRCm39) missense probably damaging 1.00
IGL03342:Srgap3 APN 6 112,752,648 (GRCm39) missense probably damaging 1.00
R0007:Srgap3 UTSW 6 112,806,473 (GRCm39) missense probably damaging 1.00
R0607:Srgap3 UTSW 6 112,700,080 (GRCm39) missense probably damaging 1.00
R1628:Srgap3 UTSW 6 112,716,331 (GRCm39) missense probably damaging 0.99
R1669:Srgap3 UTSW 6 112,699,865 (GRCm39) missense probably benign 0.36
R1858:Srgap3 UTSW 6 112,748,479 (GRCm39) missense probably damaging 1.00
R1876:Srgap3 UTSW 6 112,752,527 (GRCm39) missense probably damaging 0.98
R1896:Srgap3 UTSW 6 112,715,958 (GRCm39) missense probably benign 0.11
R2159:Srgap3 UTSW 6 112,748,339 (GRCm39) missense probably damaging 0.99
R2221:Srgap3 UTSW 6 112,923,454 (GRCm39) missense probably damaging 0.98
R2862:Srgap3 UTSW 6 112,699,933 (GRCm39) missense probably damaging 0.99
R3160:Srgap3 UTSW 6 112,706,619 (GRCm39) missense probably benign 0.00
R3162:Srgap3 UTSW 6 112,706,619 (GRCm39) missense probably benign 0.00
R4092:Srgap3 UTSW 6 112,700,045 (GRCm39) missense probably benign 0.00
R4561:Srgap3 UTSW 6 112,758,015 (GRCm39) missense probably damaging 0.98
R4781:Srgap3 UTSW 6 112,734,386 (GRCm39) intron probably benign
R4825:Srgap3 UTSW 6 112,704,271 (GRCm39) missense probably benign
R4887:Srgap3 UTSW 6 112,723,895 (GRCm39) missense probably damaging 1.00
R5304:Srgap3 UTSW 6 112,743,900 (GRCm39) missense probably damaging 1.00
R5556:Srgap3 UTSW 6 112,716,039 (GRCm39) missense probably damaging 0.99
R5672:Srgap3 UTSW 6 112,752,522 (GRCm39) missense probably benign
R5879:Srgap3 UTSW 6 112,699,807 (GRCm39) missense possibly damaging 0.67
R5944:Srgap3 UTSW 6 112,772,775 (GRCm39) missense possibly damaging 0.89
R6277:Srgap3 UTSW 6 112,716,344 (GRCm39) missense probably benign 0.02
R6298:Srgap3 UTSW 6 112,793,571 (GRCm39) missense probably damaging 0.98
R6407:Srgap3 UTSW 6 112,699,967 (GRCm39) missense probably damaging 0.99
R6408:Srgap3 UTSW 6 112,699,967 (GRCm39) missense probably damaging 0.99
R6797:Srgap3 UTSW 6 112,806,503 (GRCm39) missense probably damaging 1.00
R6852:Srgap3 UTSW 6 112,793,622 (GRCm39) missense probably damaging 1.00
R6965:Srgap3 UTSW 6 112,700,090 (GRCm39) missense probably damaging 1.00
R7055:Srgap3 UTSW 6 112,723,924 (GRCm39) missense probably damaging 0.97
R7067:Srgap3 UTSW 6 112,734,266 (GRCm39) intron probably benign
R7361:Srgap3 UTSW 6 112,723,882 (GRCm39) missense probably damaging 0.99
R7479:Srgap3 UTSW 6 112,712,794 (GRCm39) critical splice donor site probably null
R7606:Srgap3 UTSW 6 112,716,337 (GRCm39) missense probably benign 0.00
R7731:Srgap3 UTSW 6 112,743,858 (GRCm39) missense probably benign 0.36
R7787:Srgap3 UTSW 6 112,752,520 (GRCm39) missense probably benign 0.02
R7934:Srgap3 UTSW 6 112,708,450 (GRCm39) missense probably damaging 1.00
R8026:Srgap3 UTSW 6 112,716,325 (GRCm39) missense probably benign 0.00
R8040:Srgap3 UTSW 6 112,716,325 (GRCm39) missense probably benign 0.00
R8066:Srgap3 UTSW 6 112,748,339 (GRCm39) missense probably damaging 0.99
R8067:Srgap3 UTSW 6 112,716,325 (GRCm39) missense probably benign 0.00
R8090:Srgap3 UTSW 6 112,757,996 (GRCm39) nonsense probably null
R8151:Srgap3 UTSW 6 112,793,628 (GRCm39) missense probably damaging 1.00
R8248:Srgap3 UTSW 6 112,700,104 (GRCm39) missense probably damaging 1.00
R8365:Srgap3 UTSW 6 112,793,695 (GRCm39) missense probably damaging 1.00
R8369:Srgap3 UTSW 6 112,699,779 (GRCm39) missense probably benign
R8444:Srgap3 UTSW 6 112,752,509 (GRCm39) missense possibly damaging 0.56
R8509:Srgap3 UTSW 6 112,708,297 (GRCm39) nonsense probably null
R8772:Srgap3 UTSW 6 112,743,906 (GRCm39) missense probably damaging 1.00
R8827:Srgap3 UTSW 6 112,716,302 (GRCm39) missense probably damaging 1.00
R8881:Srgap3 UTSW 6 112,700,098 (GRCm39) missense probably benign
R9002:Srgap3 UTSW 6 112,757,854 (GRCm39) missense possibly damaging 0.76
R9041:Srgap3 UTSW 6 112,754,054 (GRCm39) missense probably damaging 0.99
R9198:Srgap3 UTSW 6 112,743,865 (GRCm39) missense probably damaging 1.00
R9404:Srgap3 UTSW 6 112,706,616 (GRCm39) missense probably benign 0.04
R9616:Srgap3 UTSW 6 112,748,524 (GRCm39) missense probably damaging 1.00
X0062:Srgap3 UTSW 6 112,772,747 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGACTTCTTCCAAAGCCACAGG -3'
(R):5'- TGACATTCCTCAGCAGAAGCAATCC -3'

Sequencing Primer
(F):5'- CACAGGCAGGGTGTCAAC -3'
(R):5'- GGTCTTGGACCAATGACCAATTC -3'
Posted On 2013-04-24