Incidental Mutation 'R0371:Fat1'
ID 30476
Institutional Source Beutler Lab
Gene Symbol Fat1
Ensembl Gene ENSMUSG00000070047
Gene Name FAT atypical cadherin 1
Synonyms 2310038E12Rik, mFat1, Fath
MMRRC Submission 038577-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0371 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 45388484-45505294 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45404929 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 560 (L560P)
Ref Sequence ENSEMBL: ENSMUSP00000149194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098796] [ENSMUST00000189017] [ENSMUST00000191428] [ENSMUST00000215588]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000098796
AA Change: L560P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096394
Gene: ENSMUSG00000070047
AA Change: L560P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 62 148 3.05e-6 SMART
CA 172 256 3.29e-20 SMART
Blast:CA 277 382 5e-47 BLAST
CA 387 462 2.13e-5 SMART
CA 486 568 8.35e-22 SMART
CA 592 670 2.11e-2 SMART
CA 740 821 5.09e-26 SMART
CA 845 926 6.27e-26 SMART
CA 950 1031 4.07e-25 SMART
CA 1057 1138 5.13e-31 SMART
CA 1162 1244 8.79e-30 SMART
CA 1276 1351 2.06e-3 SMART
CA 1379 1456 1.63e-15 SMART
CA 1480 1562 3.29e-20 SMART
CA 1586 1667 2.34e-16 SMART
CA 1691 1765 1.16e-20 SMART
CA 1796 1879 6.27e-26 SMART
CA 1903 1979 1.47e-8 SMART
CA 2003 2081 2.65e-15 SMART
CA 2105 2181 2.14e-10 SMART
CA 2203 2283 9.82e-19 SMART
CA 2307 2390 7.54e-29 SMART
CA 2414 2492 3.29e-11 SMART
CA 2516 2596 6.48e-19 SMART
CA 2620 2703 3.48e-10 SMART
CA 2719 2809 2.26e-9 SMART
CA 2833 2918 8.08e-29 SMART
CA 2942 3023 5.99e-23 SMART
CA 3047 3125 2.63e-28 SMART
CA 3149 3230 2.79e-32 SMART
CA 3254 3335 5.25e-28 SMART
CA 3359 3440 4.46e-31 SMART
CA 3464 3545 1.25e-11 SMART
CA 3569 3641 5.67e-2 SMART
LamG 3853 3987 6.51e-36 SMART
EGF 4018 4052 8.57e-5 SMART
EGF 4057 4090 3.94e-4 SMART
EGF 4094 4127 4.29e-5 SMART
EGF_CA 4129 4165 1.81e-12 SMART
transmembrane domain 4182 4204 N/A INTRINSIC
low complexity region 4308 4324 N/A INTRINSIC
low complexity region 4436 4457 N/A INTRINSIC
low complexity region 4472 4483 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189017
AA Change: L560P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000191428
AA Change: L560P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140596
Gene: ENSMUSG00000070047
AA Change: L560P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 62 148 3.05e-6 SMART
CA 172 256 3.29e-20 SMART
Blast:CA 277 382 5e-47 BLAST
CA 387 462 2.13e-5 SMART
CA 486 568 8.35e-22 SMART
CA 592 670 2.11e-2 SMART
CA 740 821 5.09e-26 SMART
CA 845 926 6.27e-26 SMART
CA 950 1031 4.07e-25 SMART
CA 1057 1138 5.13e-31 SMART
CA 1162 1244 8.79e-30 SMART
CA 1276 1351 2.06e-3 SMART
CA 1379 1456 1.63e-15 SMART
CA 1480 1562 3.29e-20 SMART
CA 1586 1667 2.34e-16 SMART
CA 1691 1765 1.16e-20 SMART
CA 1796 1879 6.27e-26 SMART
CA 1903 1979 1.47e-8 SMART
CA 2003 2081 2.65e-15 SMART
CA 2105 2181 2.14e-10 SMART
CA 2203 2283 9.82e-19 SMART
CA 2307 2390 7.54e-29 SMART
CA 2414 2492 3.29e-11 SMART
CA 2516 2596 6.48e-19 SMART
CA 2620 2703 3.48e-10 SMART
CA 2719 2809 2.26e-9 SMART
CA 2833 2918 8.08e-29 SMART
CA 2942 3023 5.99e-23 SMART
CA 3047 3125 2.63e-28 SMART
CA 3149 3230 2.79e-32 SMART
CA 3254 3335 5.25e-28 SMART
CA 3359 3440 4.46e-31 SMART
CA 3464 3545 1.25e-11 SMART
CA 3569 3641 5.67e-2 SMART
LamG 3853 3987 6.51e-36 SMART
EGF 4018 4052 8.57e-5 SMART
EGF 4057 4090 3.94e-4 SMART
EGF 4094 4127 4.29e-5 SMART
EGF_CA 4129 4165 1.81e-12 SMART
transmembrane domain 4182 4204 N/A INTRINSIC
low complexity region 4308 4324 N/A INTRINSIC
low complexity region 4436 4457 N/A INTRINSIC
low complexity region 4472 4483 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215588
AA Change: L560P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8568 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.6%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an ortholog of the Drosophila fat gene, which encodes a tumor suppressor essential for controlling cell proliferation during Drosophila development. The gene product is a member of the cadherin superfamily, a group of integral membrane proteins characterized by the presence of cadherin-type repeats. In addition to containing 34 tandem cadherin-type repeats, the gene product has five epidermal growth factor (EGF)-like repeats and one laminin A-G domain. This gene is expressed at high levels in a number of fetal epithelia. Its product probably functions as an adhesion molecule and/or signaling receptor, and is likely to be important in developmental processes and cell communication. Transcript variants derived from alternative splicing and/or alternative promoter usage exist, but they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit holoprosencephaly, anophthalmia, kidney defects and perinatal lethality. Mice homozygous for a hypomorphic allele exhibit altered shoulder girdle and facial musculature, retinal defects, abnormal inner earpatterning and kidney defects. [provided by MGI curators]
Allele List at MGI

All alleles(56) : Targeted, other(1) Gene trapped(55)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 G A 16: 4,105,911 (GRCm39) R1068C probably benign Het
Afmid C T 11: 117,725,966 (GRCm39) probably benign Het
Aqr A G 2: 113,988,085 (GRCm39) V159A possibly damaging Het
Atp6v0d2 G C 4: 19,880,033 (GRCm39) T288R possibly damaging Het
Btnl1 T C 17: 34,600,031 (GRCm39) V178A probably damaging Het
Ccdc110 T A 8: 46,395,843 (GRCm39) M578K possibly damaging Het
Ccdc38 G T 10: 93,398,674 (GRCm39) E51* probably null Het
Cep290 T A 10: 100,354,426 (GRCm39) probably benign Het
Cilp2 T C 8: 70,334,256 (GRCm39) E914G probably damaging Het
Col6a2 T C 10: 76,450,307 (GRCm39) N208S probably benign Het
Ctrb1 T A 8: 112,413,783 (GRCm39) I194F probably benign Het
Cyp4a12a C G 4: 115,183,880 (GRCm39) R229G probably damaging Het
Dach1 C T 14: 98,207,339 (GRCm39) V337M probably damaging Het
Dcbld2 A G 16: 58,271,186 (GRCm39) N321S probably benign Het
Enpep C T 3: 129,077,516 (GRCm39) probably null Het
Fdxr T C 11: 115,166,915 (GRCm39) H58R possibly damaging Het
Filip1 G T 9: 79,767,373 (GRCm39) P147T probably damaging Het
Fras1 G A 5: 96,703,190 (GRCm39) E318K possibly damaging Het
Grk2 T C 19: 4,341,614 (GRCm39) probably null Het
Gvin-ps6 A T 7: 106,021,986 (GRCm39) C339S unknown Het
Havcr1 T C 11: 46,643,416 (GRCm39) I112T possibly damaging Het
Hjurp G A 1: 88,205,090 (GRCm39) probably benign Het
Ildr2 G A 1: 166,131,133 (GRCm39) V330I probably damaging Het
Ino80d T C 1: 63,097,115 (GRCm39) probably benign Het
Iqsec1 A G 6: 90,647,385 (GRCm39) probably benign Het
Irf2bpl C T 12: 86,928,417 (GRCm39) W752* probably null Het
Kdr T A 5: 76,102,494 (GRCm39) H1211L probably benign Het
Klri2 A G 6: 129,709,106 (GRCm39) *249R probably null Het
Ktn1 A T 14: 47,961,460 (GRCm39) K1054* probably null Het
Lactb2 A G 1: 13,720,984 (GRCm39) S83P possibly damaging Het
Lrrc3b A T 14: 15,358,560 (GRCm38) C15* probably null Het
Mrs2 T C 13: 25,177,078 (GRCm39) I430V probably benign Het
Myo3b C T 2: 70,083,304 (GRCm39) probably benign Het
Nbas C T 12: 13,381,096 (GRCm39) T696I probably damaging Het
Nsun6 T C 2: 15,034,898 (GRCm39) D240G probably damaging Het
Nup107 T C 10: 117,599,674 (GRCm39) E615G probably damaging Het
Or2a25 A T 6: 42,888,872 (GRCm39) R138S probably benign Het
Or3a1d T A 11: 74,237,760 (GRCm39) I217F probably damaging Het
Or4k77 A T 2: 111,199,498 (GRCm39) I174L probably benign Het
Or5ac23 A G 16: 59,149,585 (GRCm39) C96R possibly damaging Het
Pabpc1l G A 2: 163,877,192 (GRCm39) V256M probably benign Het
Sf3b2 C T 19: 5,324,852 (GRCm39) D845N probably damaging Het
Sik1 T C 17: 32,067,958 (GRCm39) D409G probably benign Het
Slc22a22 A T 15: 57,113,131 (GRCm39) D369E possibly damaging Het
Smg1 T A 7: 117,767,523 (GRCm39) probably benign Het
Snap29 C A 16: 17,224,067 (GRCm39) D27E probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Sorcs3 A G 19: 48,592,333 (GRCm39) I333V probably benign Het
Spag7 A G 11: 70,555,622 (GRCm39) M105T probably damaging Het
Srgap3 A T 6: 112,748,432 (GRCm39) S407T probably damaging Het
Supt6 T C 11: 78,113,983 (GRCm39) N854S probably benign Het
Syne2 T C 12: 75,980,619 (GRCm39) S1460P probably damaging Het
Taok3 C T 5: 117,344,752 (GRCm39) Q160* probably null Het
Tchhl1 C A 3: 93,376,884 (GRCm39) A27E probably damaging Het
Tet1 T C 10: 62,714,178 (GRCm39) D539G probably damaging Het
Tut1 T C 19: 8,940,137 (GRCm39) F374L probably damaging Het
Unc5c C T 3: 141,533,283 (GRCm39) P770S probably benign Het
Vmn2r101 T A 17: 19,810,394 (GRCm39) N393K probably benign Het
Vmn2r94 T A 17: 18,477,556 (GRCm39) H285L probably benign Het
Wdr62 G A 7: 29,941,583 (GRCm39) S700L possibly damaging Het
Wscd1 A G 11: 71,679,549 (GRCm39) D474G probably damaging Het
Zcchc7 A G 4: 44,762,190 (GRCm39) N106S probably damaging Het
Zfp345 G T 2: 150,313,983 (GRCm39) T518N possibly damaging Het
Zfp648 A T 1: 154,080,413 (GRCm39) S191C possibly damaging Het
Zkscan8 C T 13: 21,710,844 (GRCm39) E89K probably damaging Het
Other mutations in Fat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fat1 APN 8 45,477,639 (GRCm39) missense possibly damaging 0.93
IGL00157:Fat1 APN 8 45,404,707 (GRCm39) missense possibly damaging 0.96
IGL00481:Fat1 APN 8 45,503,977 (GRCm39) missense probably benign 0.18
IGL00983:Fat1 APN 8 45,486,427 (GRCm39) missense probably damaging 1.00
IGL01089:Fat1 APN 8 45,470,894 (GRCm39) missense probably damaging 1.00
IGL01135:Fat1 APN 8 45,477,877 (GRCm39) missense probably damaging 1.00
IGL01143:Fat1 APN 8 45,488,569 (GRCm39) missense possibly damaging 0.72
IGL01155:Fat1 APN 8 45,476,986 (GRCm39) missense probably damaging 1.00
IGL01376:Fat1 APN 8 45,479,878 (GRCm39) missense probably benign 0.00
IGL01411:Fat1 APN 8 45,479,837 (GRCm39) missense probably damaging 1.00
IGL01443:Fat1 APN 8 45,493,613 (GRCm39) missense probably damaging 1.00
IGL01453:Fat1 APN 8 45,504,307 (GRCm39) missense probably damaging 1.00
IGL01606:Fat1 APN 8 45,476,086 (GRCm39) missense probably benign 0.26
IGL01622:Fat1 APN 8 45,482,592 (GRCm39) missense possibly damaging 0.64
IGL01623:Fat1 APN 8 45,482,592 (GRCm39) missense possibly damaging 0.64
IGL01672:Fat1 APN 8 45,493,737 (GRCm39) missense probably benign 0.05
IGL01735:Fat1 APN 8 45,489,276 (GRCm39) missense probably benign 0.07
IGL01793:Fat1 APN 8 45,442,149 (GRCm39) missense probably benign
IGL01820:Fat1 APN 8 45,463,539 (GRCm39) missense probably damaging 1.00
IGL01969:Fat1 APN 8 45,405,636 (GRCm39) missense probably damaging 0.98
IGL02012:Fat1 APN 8 45,480,577 (GRCm39) missense possibly damaging 0.95
IGL02227:Fat1 APN 8 45,476,696 (GRCm39) missense probably damaging 1.00
IGL02256:Fat1 APN 8 45,403,369 (GRCm39) missense probably damaging 1.00
IGL02273:Fat1 APN 8 45,403,368 (GRCm39) missense probably damaging 1.00
IGL02317:Fat1 APN 8 45,478,855 (GRCm39) missense probably benign 0.33
IGL02324:Fat1 APN 8 45,493,593 (GRCm39) missense probably damaging 1.00
IGL02336:Fat1 APN 8 45,404,620 (GRCm39) missense probably benign 0.16
IGL02442:Fat1 APN 8 45,403,360 (GRCm39) missense probably benign 0.02
IGL02486:Fat1 APN 8 45,478,109 (GRCm39) missense probably benign 0.16
IGL02551:Fat1 APN 8 45,504,435 (GRCm39) missense probably damaging 1.00
IGL02617:Fat1 APN 8 45,488,628 (GRCm39) missense probably benign 0.31
IGL02698:Fat1 APN 8 45,476,201 (GRCm39) missense probably benign
IGL02885:Fat1 APN 8 45,442,204 (GRCm39) missense probably benign 0.01
IGL02904:Fat1 APN 8 45,493,719 (GRCm39) missense probably damaging 1.00
IGL02953:Fat1 APN 8 45,477,351 (GRCm39) missense probably damaging 1.00
IGL03108:Fat1 APN 8 45,476,651 (GRCm39) missense probably damaging 1.00
IGL03153:Fat1 APN 8 45,483,160 (GRCm39) missense possibly damaging 0.83
IGL03183:Fat1 APN 8 45,403,623 (GRCm39) missense probably damaging 0.99
IGL03327:Fat1 APN 8 45,403,505 (GRCm39) missense probably damaging 1.00
IGL03405:Fat1 APN 8 45,478,278 (GRCm39) missense probably damaging 1.00
Laggardly UTSW 8 45,497,501 (GRCm39) missense probably damaging 1.00
R2257_fat1_465 UTSW 8 45,403,408 (GRCm39) missense probably damaging 1.00
Shrinkage UTSW 8 45,471,074 (GRCm39) missense probably damaging 1.00
F5493:Fat1 UTSW 8 45,478,517 (GRCm39) missense probably damaging 0.99
G1citation:Fat1 UTSW 8 45,479,441 (GRCm39) missense probably damaging 1.00
I2289:Fat1 UTSW 8 45,478,033 (GRCm39) missense probably benign 0.01
IGL02837:Fat1 UTSW 8 45,470,471 (GRCm39) missense probably benign 0.00
PIT4283001:Fat1 UTSW 8 45,490,244 (GRCm39) missense probably damaging 1.00
PIT4283001:Fat1 UTSW 8 45,482,577 (GRCm39) missense probably damaging 1.00
PIT4576001:Fat1 UTSW 8 45,477,682 (GRCm39) missense probably damaging 1.00
R0040:Fat1 UTSW 8 45,479,441 (GRCm39) missense probably damaging 1.00
R0040:Fat1 UTSW 8 45,479,441 (GRCm39) missense probably damaging 1.00
R0078:Fat1 UTSW 8 45,406,336 (GRCm39) missense probably damaging 1.00
R0197:Fat1 UTSW 8 45,479,590 (GRCm39) missense probably benign 0.00
R0328:Fat1 UTSW 8 45,476,827 (GRCm39) missense probably benign 0.35
R0367:Fat1 UTSW 8 45,477,350 (GRCm39) missense probably damaging 1.00
R0380:Fat1 UTSW 8 45,463,160 (GRCm39) missense probably damaging 0.97
R0389:Fat1 UTSW 8 45,403,385 (GRCm39) missense probably benign 0.00
R0433:Fat1 UTSW 8 45,477,686 (GRCm39) missense possibly damaging 0.51
R0456:Fat1 UTSW 8 45,482,571 (GRCm39) missense probably damaging 1.00
R0494:Fat1 UTSW 8 45,403,579 (GRCm39) missense probably damaging 1.00
R0506:Fat1 UTSW 8 45,475,988 (GRCm39) missense probably damaging 0.99
R0512:Fat1 UTSW 8 45,404,369 (GRCm39) nonsense probably null
R0624:Fat1 UTSW 8 45,504,205 (GRCm39) missense possibly damaging 0.46
R0701:Fat1 UTSW 8 45,479,590 (GRCm39) missense probably benign 0.00
R0723:Fat1 UTSW 8 45,479,786 (GRCm39) missense probably damaging 1.00
R0787:Fat1 UTSW 8 45,493,592 (GRCm39) missense probably damaging 1.00
R0788:Fat1 UTSW 8 45,477,020 (GRCm39) missense probably benign 0.27
R0862:Fat1 UTSW 8 45,471,074 (GRCm39) missense probably damaging 1.00
R0864:Fat1 UTSW 8 45,471,074 (GRCm39) missense probably damaging 1.00
R0907:Fat1 UTSW 8 45,479,635 (GRCm39) missense probably benign 0.08
R0962:Fat1 UTSW 8 45,486,363 (GRCm39) splice site probably benign
R1051:Fat1 UTSW 8 45,497,543 (GRCm39) missense probably damaging 1.00
R1156:Fat1 UTSW 8 45,492,927 (GRCm39) missense possibly damaging 0.94
R1237:Fat1 UTSW 8 45,497,316 (GRCm39) missense probably damaging 1.00
R1468:Fat1 UTSW 8 45,463,582 (GRCm39) missense probably damaging 1.00
R1468:Fat1 UTSW 8 45,463,582 (GRCm39) missense probably damaging 1.00
R1478:Fat1 UTSW 8 45,478,659 (GRCm39) missense probably damaging 0.99
R1482:Fat1 UTSW 8 45,406,281 (GRCm39) missense probably benign 0.04
R1496:Fat1 UTSW 8 45,486,427 (GRCm39) missense probably damaging 1.00
R1498:Fat1 UTSW 8 45,478,521 (GRCm39) nonsense probably null
R1508:Fat1 UTSW 8 45,479,899 (GRCm39) missense probably benign 0.01
R1577:Fat1 UTSW 8 45,476,420 (GRCm39) missense probably benign 0.30
R1646:Fat1 UTSW 8 45,471,079 (GRCm39) missense probably damaging 1.00
R1652:Fat1 UTSW 8 45,478,215 (GRCm39) nonsense probably null
R1656:Fat1 UTSW 8 45,478,567 (GRCm39) nonsense probably null
R1662:Fat1 UTSW 8 45,406,201 (GRCm39) missense probably benign 0.20
R1672:Fat1 UTSW 8 45,489,872 (GRCm39) missense probably damaging 1.00
R1704:Fat1 UTSW 8 45,478,613 (GRCm39) missense probably damaging 1.00
R1708:Fat1 UTSW 8 45,477,829 (GRCm39) missense probably damaging 1.00
R1710:Fat1 UTSW 8 45,463,519 (GRCm39) missense probably benign 0.00
R1812:Fat1 UTSW 8 45,489,840 (GRCm39) missense probably damaging 1.00
R1872:Fat1 UTSW 8 45,491,386 (GRCm39) missense probably damaging 1.00
R1872:Fat1 UTSW 8 45,406,341 (GRCm39) missense probably benign 0.01
R1883:Fat1 UTSW 8 45,504,184 (GRCm39) missense probably benign 0.17
R1893:Fat1 UTSW 8 45,476,893 (GRCm39) missense probably damaging 1.00
R1930:Fat1 UTSW 8 45,497,265 (GRCm39) missense possibly damaging 0.91
R1931:Fat1 UTSW 8 45,497,265 (GRCm39) missense possibly damaging 0.91
R1952:Fat1 UTSW 8 45,486,963 (GRCm39) missense probably benign 0.00
R1957:Fat1 UTSW 8 45,493,719 (GRCm39) missense probably damaging 1.00
R1999:Fat1 UTSW 8 45,405,430 (GRCm39) missense probably damaging 0.96
R2019:Fat1 UTSW 8 45,476,783 (GRCm39) missense probably damaging 1.00
R2062:Fat1 UTSW 8 45,477,369 (GRCm39) missense probably damaging 1.00
R2062:Fat1 UTSW 8 45,479,741 (GRCm39) missense probably damaging 1.00
R2117:Fat1 UTSW 8 45,490,500 (GRCm39) missense probably benign 0.33
R2196:Fat1 UTSW 8 45,477,683 (GRCm39) missense probably damaging 1.00
R2204:Fat1 UTSW 8 45,476,737 (GRCm39) missense probably damaging 1.00
R2256:Fat1 UTSW 8 45,403,408 (GRCm39) missense probably damaging 1.00
R2257:Fat1 UTSW 8 45,403,408 (GRCm39) missense probably damaging 1.00
R2409:Fat1 UTSW 8 45,493,567 (GRCm39) splice site probably benign
R2416:Fat1 UTSW 8 45,479,420 (GRCm39) missense probably damaging 1.00
R3021:Fat1 UTSW 8 45,497,048 (GRCm39) missense probably damaging 1.00
R3108:Fat1 UTSW 8 45,498,210 (GRCm39) splice site probably null
R3109:Fat1 UTSW 8 45,498,210 (GRCm39) splice site probably null
R3196:Fat1 UTSW 8 45,404,905 (GRCm39) missense probably benign 0.00
R3683:Fat1 UTSW 8 45,470,975 (GRCm39) missense probably benign
R3732:Fat1 UTSW 8 45,406,306 (GRCm39) missense possibly damaging 0.85
R3732:Fat1 UTSW 8 45,406,306 (GRCm39) missense possibly damaging 0.85
R3733:Fat1 UTSW 8 45,406,306 (GRCm39) missense possibly damaging 0.85
R3753:Fat1 UTSW 8 45,478,516 (GRCm39) missense probably damaging 0.97
R3905:Fat1 UTSW 8 45,476,072 (GRCm39) missense probably benign 0.00
R3907:Fat1 UTSW 8 45,476,072 (GRCm39) missense probably benign 0.00
R3908:Fat1 UTSW 8 45,476,072 (GRCm39) missense probably benign 0.00
R4060:Fat1 UTSW 8 45,478,518 (GRCm39) missense probably benign 0.09
R4061:Fat1 UTSW 8 45,478,518 (GRCm39) missense probably benign 0.09
R4062:Fat1 UTSW 8 45,478,518 (GRCm39) missense probably benign 0.09
R4063:Fat1 UTSW 8 45,478,518 (GRCm39) missense probably benign 0.09
R4078:Fat1 UTSW 8 45,442,159 (GRCm39) missense probably damaging 0.99
R4105:Fat1 UTSW 8 45,489,888 (GRCm39) missense probably damaging 1.00
R4118:Fat1 UTSW 8 45,503,981 (GRCm39) missense probably damaging 1.00
R4118:Fat1 UTSW 8 45,463,474 (GRCm39) missense probably damaging 1.00
R4161:Fat1 UTSW 8 45,489,824 (GRCm39) missense probably benign 0.00
R4364:Fat1 UTSW 8 45,405,999 (GRCm39) missense probably benign 0.01
R4394:Fat1 UTSW 8 45,405,383 (GRCm39) missense probably damaging 0.98
R4395:Fat1 UTSW 8 45,405,383 (GRCm39) missense probably damaging 0.98
R4396:Fat1 UTSW 8 45,405,383 (GRCm39) missense probably damaging 0.98
R4412:Fat1 UTSW 8 45,476,636 (GRCm39) missense probably damaging 0.99
R4542:Fat1 UTSW 8 45,494,931 (GRCm39) missense probably damaging 1.00
R4591:Fat1 UTSW 8 45,479,279 (GRCm39) missense probably benign
R4606:Fat1 UTSW 8 45,403,720 (GRCm39) missense possibly damaging 0.47
R4612:Fat1 UTSW 8 45,478,184 (GRCm39) missense probably damaging 1.00
R4730:Fat1 UTSW 8 45,486,514 (GRCm39) missense probably damaging 1.00
R4778:Fat1 UTSW 8 45,491,363 (GRCm39) missense probably benign 0.04
R4824:Fat1 UTSW 8 45,442,151 (GRCm39) missense probably damaging 1.00
R4829:Fat1 UTSW 8 45,489,199 (GRCm39) missense probably damaging 1.00
R4832:Fat1 UTSW 8 45,466,102 (GRCm39) missense possibly damaging 0.95
R4849:Fat1 UTSW 8 45,466,007 (GRCm39) missense probably benign 0.15
R4896:Fat1 UTSW 8 45,404,317 (GRCm39) missense possibly damaging 0.68
R4927:Fat1 UTSW 8 45,476,000 (GRCm39) missense probably damaging 0.96
R4941:Fat1 UTSW 8 45,489,312 (GRCm39) missense probably benign 0.00
R5011:Fat1 UTSW 8 45,484,300 (GRCm39) critical splice acceptor site probably null
R5040:Fat1 UTSW 8 45,476,417 (GRCm39) missense probably damaging 1.00
R5112:Fat1 UTSW 8 45,477,319 (GRCm39) missense probably damaging 1.00
R5151:Fat1 UTSW 8 45,404,851 (GRCm39) missense possibly damaging 0.74
R5161:Fat1 UTSW 8 45,405,549 (GRCm39) missense probably benign 0.00
R5162:Fat1 UTSW 8 45,478,846 (GRCm39) missense probably benign 0.02
R5353:Fat1 UTSW 8 45,489,168 (GRCm39) missense probably benign 0.13
R5425:Fat1 UTSW 8 45,478,922 (GRCm39) missense possibly damaging 0.64
R5458:Fat1 UTSW 8 45,466,090 (GRCm39) missense probably damaging 1.00
R5479:Fat1 UTSW 8 45,489,912 (GRCm39) missense possibly damaging 0.88
R5543:Fat1 UTSW 8 45,476,516 (GRCm39) missense probably damaging 0.99
R5569:Fat1 UTSW 8 45,492,873 (GRCm39) missense probably damaging 0.98
R5610:Fat1 UTSW 8 45,406,109 (GRCm39) nonsense probably null
R5734:Fat1 UTSW 8 45,504,246 (GRCm39) missense probably damaging 0.99
R5832:Fat1 UTSW 8 45,470,460 (GRCm39) missense possibly damaging 0.65
R5860:Fat1 UTSW 8 45,504,166 (GRCm39) missense probably benign
R5886:Fat1 UTSW 8 45,486,432 (GRCm39) missense probably damaging 1.00
R5886:Fat1 UTSW 8 45,480,718 (GRCm39) critical splice donor site probably null
R5919:Fat1 UTSW 8 45,479,910 (GRCm39) critical splice donor site probably null
R5930:Fat1 UTSW 8 45,497,073 (GRCm39) missense probably benign 0.10
R5960:Fat1 UTSW 8 45,486,405 (GRCm39) missense probably damaging 1.00
R5988:Fat1 UTSW 8 45,482,493 (GRCm39) missense probably benign 0.00
R6166:Fat1 UTSW 8 45,405,522 (GRCm39) missense probably damaging 1.00
R6184:Fat1 UTSW 8 45,406,429 (GRCm39) missense probably benign 0.00
R6208:Fat1 UTSW 8 45,480,650 (GRCm39) missense probably damaging 0.99
R6351:Fat1 UTSW 8 45,486,532 (GRCm39) missense probably damaging 1.00
R6391:Fat1 UTSW 8 45,405,379 (GRCm39) missense possibly damaging 0.69
R6701:Fat1 UTSW 8 45,403,718 (GRCm39) missense probably damaging 1.00
R6702:Fat1 UTSW 8 45,406,083 (GRCm39) missense probably benign 0.28
R6703:Fat1 UTSW 8 45,406,083 (GRCm39) missense probably benign 0.28
R6704:Fat1 UTSW 8 45,477,410 (GRCm39) missense probably damaging 1.00
R6822:Fat1 UTSW 8 45,479,441 (GRCm39) missense probably damaging 1.00
R6852:Fat1 UTSW 8 45,488,635 (GRCm39) missense possibly damaging 0.46
R6863:Fat1 UTSW 8 45,497,501 (GRCm39) missense probably damaging 1.00
R6885:Fat1 UTSW 8 45,405,489 (GRCm39) missense possibly damaging 0.94
R6912:Fat1 UTSW 8 45,504,060 (GRCm39) missense probably benign 0.00
R6927:Fat1 UTSW 8 45,477,532 (GRCm39) missense probably benign 0.41
R6964:Fat1 UTSW 8 45,496,982 (GRCm39) missense probably damaging 1.00
R7010:Fat1 UTSW 8 45,406,386 (GRCm39) nonsense probably null
R7062:Fat1 UTSW 8 45,403,253 (GRCm39) start codon destroyed probably null 0.99
R7063:Fat1 UTSW 8 45,493,812 (GRCm39) missense probably benign 0.09
R7071:Fat1 UTSW 8 45,442,145 (GRCm39) missense possibly damaging 0.67
R7117:Fat1 UTSW 8 45,484,505 (GRCm39) missense probably damaging 0.98
R7146:Fat1 UTSW 8 45,403,962 (GRCm39) missense probably benign
R7210:Fat1 UTSW 8 45,476,540 (GRCm39) missense probably damaging 1.00
R7227:Fat1 UTSW 8 45,463,646 (GRCm39) missense probably benign 0.08
R7270:Fat1 UTSW 8 45,490,475 (GRCm39) missense probably damaging 1.00
R7373:Fat1 UTSW 8 45,479,702 (GRCm39) missense probably damaging 1.00
R7390:Fat1 UTSW 8 45,405,511 (GRCm39) missense possibly damaging 0.81
R7465:Fat1 UTSW 8 45,497,189 (GRCm39) missense probably benign 0.35
R7476:Fat1 UTSW 8 45,484,311 (GRCm39) missense probably benign 0.01
R7483:Fat1 UTSW 8 45,476,197 (GRCm39) missense probably benign 0.13
R7484:Fat1 UTSW 8 45,489,221 (GRCm39) missense probably damaging 1.00
R7526:Fat1 UTSW 8 45,476,464 (GRCm39) missense probably damaging 1.00
R7549:Fat1 UTSW 8 45,442,031 (GRCm39) missense probably benign 0.01
R7554:Fat1 UTSW 8 45,490,202 (GRCm39) missense possibly damaging 0.88
R7620:Fat1 UTSW 8 45,462,887 (GRCm39) missense possibly damaging 0.95
R7652:Fat1 UTSW 8 45,406,336 (GRCm39) missense probably damaging 1.00
R7694:Fat1 UTSW 8 45,441,967 (GRCm39) critical splice acceptor site probably null
R7746:Fat1 UTSW 8 45,404,670 (GRCm39) missense probably damaging 0.96
R7762:Fat1 UTSW 8 45,490,374 (GRCm39) missense probably damaging 0.99
R7762:Fat1 UTSW 8 45,476,359 (GRCm39) missense probably damaging 1.00
R7782:Fat1 UTSW 8 45,403,948 (GRCm39) missense probably damaging 1.00
R7801:Fat1 UTSW 8 45,495,260 (GRCm39) missense probably damaging 1.00
R7807:Fat1 UTSW 8 45,495,010 (GRCm39) missense probably damaging 1.00
R7821:Fat1 UTSW 8 45,403,261 (GRCm39) missense probably benign
R7869:Fat1 UTSW 8 45,504,259 (GRCm39) missense probably benign 0.02
R8034:Fat1 UTSW 8 45,404,728 (GRCm39) missense probably benign 0.28
R8094:Fat1 UTSW 8 45,405,739 (GRCm39) missense probably damaging 0.98
R8111:Fat1 UTSW 8 45,479,095 (GRCm39) missense possibly damaging 0.94
R8220:Fat1 UTSW 8 45,492,993 (GRCm39) missense probably null
R8221:Fat1 UTSW 8 45,406,390 (GRCm39) missense
R8233:Fat1 UTSW 8 45,405,055 (GRCm39) missense
R8250:Fat1 UTSW 8 45,406,336 (GRCm39) missense probably damaging 1.00
R8279:Fat1 UTSW 8 45,483,384 (GRCm39) critical splice donor site probably null
R8726:Fat1 UTSW 8 45,477,206 (GRCm39) missense probably benign 0.23
R8875:Fat1 UTSW 8 45,493,600 (GRCm39) missense probably damaging 1.00
R8937:Fat1 UTSW 8 45,483,350 (GRCm39) missense probably damaging 1.00
R8950:Fat1 UTSW 8 45,476,158 (GRCm39) missense probably damaging 1.00
R8971:Fat1 UTSW 8 45,495,331 (GRCm39) missense probably damaging 1.00
R8976:Fat1 UTSW 8 45,484,332 (GRCm39) missense probably benign 0.02
R9000:Fat1 UTSW 8 45,497,587 (GRCm39) nonsense probably null
R9032:Fat1 UTSW 8 45,492,894 (GRCm39) missense probably benign 0.01
R9076:Fat1 UTSW 8 45,492,938 (GRCm39) missense probably damaging 1.00
R9083:Fat1 UTSW 8 45,491,336 (GRCm39) missense probably benign 0.00
R9083:Fat1 UTSW 8 45,466,127 (GRCm39) missense possibly damaging 0.76
R9103:Fat1 UTSW 8 45,404,850 (GRCm39) missense probably benign 0.38
R9124:Fat1 UTSW 8 45,478,064 (GRCm39) missense possibly damaging 0.48
R9124:Fat1 UTSW 8 45,403,363 (GRCm39) missense probably benign
R9128:Fat1 UTSW 8 45,462,878 (GRCm39) missense probably benign 0.14
R9148:Fat1 UTSW 8 45,405,682 (GRCm39) missense possibly damaging 0.81
R9162:Fat1 UTSW 8 45,404,352 (GRCm39) missense probably damaging 1.00
R9209:Fat1 UTSW 8 45,404,791 (GRCm39) missense possibly damaging 0.80
R9276:Fat1 UTSW 8 45,488,514 (GRCm39) missense probably damaging 0.99
R9303:Fat1 UTSW 8 45,463,498 (GRCm39) missense probably damaging 1.00
R9319:Fat1 UTSW 8 45,406,060 (GRCm39) missense probably damaging 1.00
R9392:Fat1 UTSW 8 45,476,228 (GRCm39) missense probably damaging 1.00
R9616:Fat1 UTSW 8 45,406,075 (GRCm39) missense probably damaging 0.99
R9712:Fat1 UTSW 8 45,470,417 (GRCm39) missense probably benign 0.05
R9756:Fat1 UTSW 8 45,496,974 (GRCm39) missense probably damaging 0.96
RF001:Fat1 UTSW 8 45,442,003 (GRCm39) missense probably benign 0.00
X0064:Fat1 UTSW 8 45,478,771 (GRCm39) missense possibly damaging 0.58
Z1088:Fat1 UTSW 8 45,476,844 (GRCm39) missense possibly damaging 0.88
Z1176:Fat1 UTSW 8 45,489,875 (GRCm39) missense probably damaging 1.00
Z1176:Fat1 UTSW 8 45,476,633 (GRCm39) missense possibly damaging 0.65
Z1176:Fat1 UTSW 8 45,403,635 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCATTGACCACTTCACGGGAAC -3'
(R):5'- CCGTCTGTCGCTGTGATTCTCAAAC -3'

Sequencing Primer
(F):5'- CCGTGAGTACCTCTGAGAATCTG -3'
(R):5'- TGAAAGGAAACCTTTGCGCC -3'
Posted On 2013-04-24